Array 1 397-6 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_WUFQ01000246.1 Rhizobium leguminosarum strain JHI388 JHI388_NODE_246_length_411_cov_0.588028, whole genome shotgun sequence		Array_Orientation: Reverse

  Position	Repeat	   %id	Spacer	Repeat_Sequence                      	Spacer_Sequence                    	Insertion/Deletion
==========	======	======	======	=====================================	===================================	==================
       396	    37	 100.0	    33	.....................................	GTGTCGTGCCTCTGCTGGCGGCCGTCGACCGTG  	
       326	    37	 100.0	    34	.....................................	GTCGTGGAGCCGCATCTACACAGCAGCGGACGGC 	
       255	    37	 100.0	    35	.....................................	CCCAGCGGGACTGGAGTTGGCCGAGGCGCTCCTTG	
       183	    37	 100.0	    34	.....................................	CGGACCGCCCAGCCCTTCTGGGTCATGCTCAACA 	
       112	    37	 100.0	    33	.....................................	GTGTCGTGCCTCTGCTGGCGGCCGTCGACCGTG  	
        42	    37	 100.0	     0	.....................................	|                                  	
==========	======	======	======	=====================================	===================================	==================
         6	    37	 100.0	    34	GTCGCTCCTCGTGACCGCGAGGAGCGTGGGTTGAAAC	                                   	       

# Left flank :   GGGTCATGCTCAAC
# Right flank :  CGTCGT

# Questionable array : NO	 Score: 6.06
# 	Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTCGCTCCTCGTGACCGCGAGGAGCGTGGGTTGAAAC
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     F [7,6] Score: 0.37/0.37
# 	Reference repeat match prediction:         R [matched GTCGCTCCTCGTGACCGCGAGGAGCGTGGGTTGAAAC with 100% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  R [-8.50,-10.10] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      NA [0-0] Score: 0/0.41
# 	AT richness analysis in flanks prediction: NA [3.3-11.7]%AT Score: 0/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         R [0.37,4.87   Confidence: HIGH] 

# Array family : I-C [Matched known repeat from this family],   
//


Array 1 469-14 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_WUFQ01000128.1 Rhizobium leguminosarum strain JHI388 JHI388_NODE_128_length_505_cov_1.25132, whole genome shotgun sequence		Array_Orientation: Reverse

  Position	Repeat	   %id	Spacer	Repeat_Sequence             	Spacer_Sequence                  	Insertion/Deletion
==========	======	======	======	============================	=================================	==================
       468	    28	 100.0	    33	............................	CCGCTCGCCGCGGCACTCAACGACCTCACCCTC	
       407	    28	 100.0	    33	............................	GAAGTCCACGAGCCCCGCCAAGGTGGAGGCGGA	
       346	    28	 100.0	    33	............................	CAATAAGGAGAGAACATGGCTACTCGTGTAAGC	
       285	    28	 100.0	    33	............................	CCGTCCAACGGCCAGTGAATCAACTCCGTGGAG	
       224	    28	 100.0	    33	............................	GCTGCCCGGGCGGACATGGCGGAAAAGCGTGCT	
       163	    28	 100.0	    33	............................	CGCGATGCTCGACGTGATCTGGCCACTACTACC	
       102	    28	 100.0	    33	............................	CAGGAGAACACCGAATGAACATTGACTACGCCC	
        41	    28	 100.0	     0	............................	|                                	
==========	======	======	======	============================	=================================	==================
         8	    28	 100.0	    33	GTGCTCCCCGCGCTAGCGGGGATGAGCC	                                 	       

# Left flank :   AGCCCACACCGCAACTATCCTCGGCATCGGCATGAT
# Right flank :  CCATGAGTCTGGAT

# Questionable array : NO	 Score: 6.26
# 	Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTGCTCCCCGCGCTAGCGGGGATGAGCC
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     F [4,3] Score: 0.37/0.37
# 	Reference repeat match prediction:         R [matched GTGCTCCCCGCGCTCGCGGGGATGAGCC with 97% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  R [-12.00,-13.50] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      NA [0-0] Score: 0/0.41
# 	AT richness analysis in flanks prediction: R [11.7-25.0]%AT Score: 0.27/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         R [0.37,5.14   Confidence: HIGH] 

# Array family : I-E [Matched known repeat from this family],   
//