Array 1 40-799 **** Predicted by CRISPRDetect 2.4 *** >NZ_QKYG01000189.1 Staphylococcus felis strain F29 k127_729, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 40 35 97.2 30 ......................-............. GATAGCGCATGATTAGTTGTGTAATGATAA 105 36 100.0 29 .................................... AATATTTTCATAGCATCGCTTCTCCTTGA 170 36 100.0 30 .................................... GACATTCAATCTCTTTTCATACGAAGAGTT 236 36 100.0 30 .................................... ATTAATCCAATTACCTAAAGGGTTAATCGT 302 36 100.0 30 .................................... TAACCAGTCACGTTCTTTTCGCCTTTTTGT 368 36 100.0 30 .................................... ATAAGGCCACGAAACCATTGCACCAACTTT 434 36 100.0 30 .................................... AGATGCAAGCGAAGCATACACCTTTATTCG 500 36 100.0 30 .................................... CCATCATTTTTATAATAATACTTTTTACGT 566 36 97.2 30 ............C....................... ATATTAAAGAAATATTGCAGAAAGTTAAAG 632 36 97.2 30 .........................A.......... TGATCCAGGGAAAGGTAACTTATACACGGC 698 36 94.4 30 ..............G..........A.......... ATGATGTACGTACCATGTACATTGTCCCCA 764 36 86.1 0 ........G................T....C.T.C. | ========== ====== ====== ====== ==================================== ============================== ================== 12 36 97.7 30 GTTTTAGAACTATGATTATTTAGAAGGAAGTAAAAC # Left flank : GAAGTAAAACCATAATTATTTTTGTTGGTGTATACTAAAG # Right flank : ATTTTTTTCTGAATTTTTAGATATAATGATGA # Questionable array : NO Score: 6.15 # Score Detail : 1:0, 2:3, 3:0, 4:0.89, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAACTATGATTATTTAGAAGGAAGTAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:75.00%AT] # Reference repeat match prediction: F [matched GTTTTAGCACTATGTTTATTTAGAAAGAAGTAAAAC with 92% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [-0.20,0.00] Score: 0/0.37 # Array degeneracy analysis prediction: F [1-9] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [50.0-45.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.91,0 Confidence: HIGH] # Array family : II-C [Matched known repeat from this family], // Array 1 462-33 **** Predicted by CRISPRDetect 2.4 *** >NZ_QKYG01000030.1 Staphylococcus felis strain F29 k127_132, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 461 36 94.4 30 ............C............G.......... ATATTAAAGAAATATTGCAGAAAGTGAAAG 395 36 100.0 29 .................................... AATGGTACTAAAAAGAAAGGGAACGTATT 330 36 97.2 29 ............C....................... TTTGGTTTTTTAACAGAACTGAGCAAAAA 265 36 75.0 29 A.G.A.A.....A..A......A..CA......... TGAAGAAATCAAAATATTAAGATCTGAAA 200 36 97.2 30 .............................A...... TGATCCAGGGAAAGGTAACGTATACACGGC 134 36 94.4 30 ......T.......G..................... ATGATGTACGTACCATGTACATTGTCCCCA 68 36 86.1 0 ........G................T....C.T.C. | ========== ====== ====== ====== ==================================== ============================== ================== 7 36 92.0 30 GTTTTAGAACTATGATTATTTAGAAAGAAGTAAAAC # Left flank : TTAGAAGGAAGTAAAACCCATCATTTTTATAATAATACTTTTTACG # Right flank : CATTTTTTTCTGAATTTTTAGATATAATGATGA # Questionable array : NO Score: 3.70 # Score Detail : 1:0, 2:3, 3:0, 4:0.60, 5:-1.5, 6:0.25, 7:0.01, 8:1, 9:0.34, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAACTATGATTATTTAGAAAGAAGTAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:77.78%AT] # Reference repeat match prediction: R [matched GTTTTAGCACTATGTTTATTTAGAAAGAAGTAAAAC with 95% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [0.00,-0.20] Score: 0/0.37 # Array degeneracy analysis prediction: F [7-12] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [45.0-60.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.41,4.77 Confidence: HIGH] # Array family : II-C [Matched known repeat from this family], // Array 1 1085-1 **** Predicted by CRISPRDetect 2.4 *** >NZ_QKYG01000103.1 Staphylococcus felis strain F29 k127_403, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 1084 36 100.0 29 .................................... TTTTGAAGATTTACCAGTAAGGACTTTAA 1019 36 100.0 29 .................................... GTACCACTAAAGCTTTCGTCTTTCATGTT 954 36 94.4 30 ........G................A.......... AATGCTAATGTTAAAGAAGCAGACCTTACT 888 36 100.0 29 .................................... CCTGACTCTAGACGAATGATACTTAAAGC 823 36 94.4 29 ...................A.....A.......... GGTGCAGTCATATCATCTCGTGAATTAAA 758 36 94.4 30 ............C................A...... TGTCTAACGGAAAAATCAATGAGGATACAA 692 36 97.2 30 .............................T...... GATAATACTCGTCACAACATTAGCGTTACA 626 36 100.0 30 .................................... GGTTACATTGCCTAAATATATGGTTGTGTT 560 36 97.2 30 ..............G..................... TTCAGTATTATCGTTACCACCATTAACACG 494 36 94.4 30 ..............T..........A.......... CGAGAGATGATATGACTCCACCTGCTCTGC 428 36 94.4 30 ........G......................G.... TCCATAATCTCCGAATTCTGACACAATACT 362 36 86.1 30 ........GT...............AT........T TAGTAATCCTGGGCACGTTGCAATAGTGGT 296 36 97.2 30 ..............G..................... AATGAAAGAGAAAGCATTTTCCCTGAAAGT 230 36 97.2 29 ..............G..................... AGCAGGTCAACAGTTAGTCGTATAATCAA 165 36 97.2 29 ........G........................... CTTCCGAAATTGAATGTTGGTACATGGTT 100 36 94.4 29 ............C............A.......... CATAATTATTTTTGTTGGTGTATACTAAA 35 35 97.2 0 ......................-............. | ========== ====== ====== ====== ==================================== ============================== ================== 17 36 96.2 30 GTTTTAGAACTATGATTATTTAGAAGGAAGTAAAAC # Left flank : | # Right flank : C # Questionable array : NO Score: 5.42 # Score Detail : 1:0, 2:3, 3:0, 4:0.81, 5:0, 6:0.25, 7:0.01, 8:1, 9:0.35, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAACTATGATTATTTAGAAGGAAGTAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:75.00%AT] # Reference repeat match prediction: R [matched GTTTTAGCACTATGTTTATTTAGAAAGAAGTAAAAC with 92% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [0.00,-0.20] Score: 0/0.37 # Array degeneracy analysis prediction: R [9-7] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [0.0-0.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.91 Confidence: HIGH] # Array family : II-C [Matched known repeat from this family], //