Array 1 33-240 **** Predicted by CRISPRDetect 2.4 *** >NZ_AERK01000011.1 Moraxella catarrhalis CO72 ctg00011, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 33 28 100.0 32 ............................ ACAATACCGCAGAAGGCATTTCTTTTGATAAA 93 28 100.0 32 ............................ TACCTGAAATCAGACACGATCAAATTAAATTA 153 28 100.0 32 ............................ CCAAAGACACCACACATCAGCTACTGCAAACC 213 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 4 28 100.0 32 CTTCACGACCGCACAGGTCGCTTAGAAA # Left flank : TAACAACCCCAGTGGGCGCAAACTTTTAAGGAC # Right flank : ATAACAGCAACAGGTACAACCGCCGATAAGAT # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : CTTCACGACCGCACAGGTCGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [9,5] Score: 0.37/0.37 # Reference repeat match prediction: F [matched CTTCACGACCGCACAGGTCGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-8.00,-8.50] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [26.7-30.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.28,0.37 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 181-33 **** Predicted by CRISPRDetect 2.4 *** >NZ_AERK01000024.1 Moraxella catarrhalis CO72 ctg00024, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 180 28 100.0 32 ............................ GTTGTTAAGCTTTGATTAAGTGTGTTAATACT 120 28 100.0 32 ............................ TTGATTAGTTGAGTTTATATTTGCCCAATTGG 60 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 3 28 100.0 32 CTTCACGACCGCACAGGTCGCTTAGAAA # Left flank : AAATTGCAGGTGCTGAGAGCATTAGCGATAACTT # Right flank : AGCTTTGGCGGTTTTATTCGGCTCACTTGGCGT # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : CTTCACGACCGCACAGGTCGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [5,8] Score: 0.37/0.37 # Reference repeat match prediction: R [matched CTTCACGACCGCACAGGTCGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.10,-7.40] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [25.0-33.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,5.24 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], //