Array 1 559-193 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_ANML01000138.1 Lacticaseibacillus paracasei subsp. paracasei Lpp223 contig00158, whole genome shotgun sequence		Array_Orientation: Reverse

  Position	Repeat	   %id	Spacer	Repeat_Sequence                     	Spacer_Sequence               	Insertion/Deletion
==========	======	======	======	====================================	==============================	==================
       558	    36	 100.0	    30	....................................	ACTCGTCAATATCCTTCTGCATGATCAAGT	
       492	    36	 100.0	    30	....................................	GCAATCGCGATACTTTCACCGATTGCAACA	
       426	    36	 100.0	    30	....................................	AACAAAATAATAGGAGGTTTTTACCATGGA	
       360	    36	 100.0	    30	....................................	ATGACTTTAACAATCAAATCCCAAGTTGTT	
       294	    36	 100.0	    30	....................................	TATTATCCTAACACATCCATCGAGAAGTTA	
       228	    36	 100.0	     0	....................................	|                             	
==========	======	======	======	====================================	==============================	==================
         6	    36	 100.0	    30	GTCTCAGGTAGATGTCGAATCAATCAGTTCAAGAGC	                              	       

# Left flank :   CAGTCGGGAGATTGTCG
# Right flank :  CTGAATATTCTAATGTTGTTGGATTGAAGTCAATATTTGAGACAGATTTTAAGAGACATTCAGAACCGCGTTTACCTTCCACAGCTCAAATAAATCATCAATTGCGATTAATAACTTATTTGAACCCTGGAAAGCATTAAGTCAGGCGGCCATTTGGCTCGTAAGTGTTGCAATTTCAACTTGTAAGGGGGTC

# Questionable array : NO	 Score: 6.26
# 	Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTCTCAGGTAGATGTCGAATCAATCAGTTCAAGAGC
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     NA [Repeat is AT rich:55.56%AT]
# 	Reference repeat match prediction:         R [matched GTCTCAGGTAGATGTCAGATCAATCAGTTCAAGAGC with 95% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  R [0.00,-2.50] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      NA [0-0] Score: 0/0.41
# 	AT richness analysis in flanks prediction: F [71.7-11.7]%AT Score: 0.27/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         R [0.27,4.87   Confidence: HIGH] 

# Array family : II-A/C [Matched known repeat from this family],   
//


Array 1 183-15 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_ANML01000136.1 Lacticaseibacillus paracasei subsp. paracasei Lpp223 contig00156, whole genome shotgun sequence		Array_Orientation: Reverse

  Position	Repeat	   %id	Spacer	Repeat_Sequence                     	Spacer_Sequence               	Insertion/Deletion
==========	======	======	======	====================================	==============================	==================
       182	    36	 100.0	    30	....................................	GATCGCGGCACGATTGTAAACGAAGAAACC	
       116	    36	 100.0	    30	....................................	CCAAATTGGTTAGCACCGCTTAAAGACGAA	
        50	    36	 100.0	     0	....................................	|                             	
==========	======	======	======	====================================	==============================	==================
         3	    36	 100.0	    30	GTCTCAGGTAGATGTCGAATCAATCAGTTCAAGAGC	                              	       

# Left flank :   CTGATGAAACCGCACAACAAGTTGACC
# Right flank :  CTATCAGAGGCTTAT

# Questionable array : NO	 Score: 5.67
# 	Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTCTCAGGTAGATGTCGAATCAATCAGTTCAAGAGC
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     NA [Repeat is AT rich:55.56%AT]
# 	Reference repeat match prediction:         R [matched GTCTCAGGTAGATGTCAGATCAATCAGTTCAAGAGC with 95% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  R [0.00,-2.50] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      NA [0-0] Score: 0/0.41
# 	AT richness analysis in flanks prediction: NA [15.0-23.3]%AT Score: 0/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         R [0,4.87   Confidence: HIGH] 

# Array family : II-A/C [Matched known repeat from this family],   
//