Array 1 1-289 **** Predicted by CRISPRDetect 2.4 *** >NZ_NPBF01000143.1 Virgibacillus sp. 7505 contig00143, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ================================ =================================== ================== 1 24 75.0 34 --------........................ ATGCAACTCGTTAGACATGTATGCCCTCCCAATC 59 32 100.0 34 ................................ ATCGTGTCAACTTCCCTCAAACGATAGACCACTT 125 32 100.0 35 ................................ TTTATCACTTCTATGTTGATTGGACTTGGAATTTA 192 32 96.9 34 ............G................... GCCTGTTGTATTTCCTAAACTTGGAGCAACTACA 258 32 100.0 0 ................................ | ========== ====== ====== ====== ================================ =================================== ================== 5 32 94.4 34 GTCGCACTCTATATGAGTGCGTGGATTGAAAT # Left flank : | # Right flank : ACTTTCT # Questionable array : NO Score: 8.78 # Score Detail : 1:0, 2:3, 3:3, 4:0.72, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACTCTATATGAGTGCGTGGATTGAAAT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: F Score: 4.5/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:62.50%AT] # Reference repeat match prediction: F [matched GTCGCACTCTACATGAGTGCGTGGATTGAAAT with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [0.00,0.00] Score: 0/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [0.0-8.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [9.41,0 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 307-9 **** Predicted by CRISPRDetect 2.4 *** >NZ_NPBF01000111.1 Virgibacillus sp. 7505 contig00111, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ================================ =================================== ================== 306 32 100.0 34 ................................ ATTTGAAAGTAGGGAATTTGAAAACTTTGGCCAG 240 32 100.0 34 ................................ TTCGCGATAAGGACGTAGCGGCGCTCTTTGTCGG 174 32 100.0 35 ................................ GCCAATTATAAAGTCGATCACGGCGCGACTGGCAC 107 32 100.0 35 ................................ GCAACCTGACGAGCGGCGCGGATTGGAGATATACC 40 32 100.0 0 ................................ | ========== ====== ====== ====== ================================ =================================== ================== 5 32 100.0 35 GTCGCACTCTATATGAGTGCGTGGATTGAAAT # Left flank : TGTGATAGTGATCGAG # Right flank : TATGCAACT # Questionable array : NO Score: 9.06 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACTCTATATGAGTGCGTGGATTGAAAT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: R Score: 4.5/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:56.25%AT] # Reference repeat match prediction: R [matched GTCGCACTCTACATGAGTGCGTGGATTGAAAT with 97% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-2.60,-3.40] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [8.3-16.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,9.37 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 271-42 **** Predicted by CRISPRDetect 2.4 *** >NZ_NPBF01000189.1 Virgibacillus sp. 7505 contig00189, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ========================== =========================================== ================== 270 26 100.0 42 .......................... TACAGTTTACGTGGAGCCATTTCTGAATTCGAGAAAGTCGCA 202 26 100.0 40 .......................... CTTAGCGACGATATCTCGTATTGCTTGTTCTAGGGTCGCA 136 26 100.0 43 .......................... TTTTTCTAAGCTTCCTGATTTATTCAACTGGATTGGGGTCGCA 67 26 100.0 0 .......................... | ========== ====== ====== ====== ========================== =========================================== ================== 4 26 100.0 42 CTCTGTGTGAGTGCGTGGATTGAAAT # Left flank : | # Right flank : TAGACTTGGTGACGTTATGCGGATTGTCCCGTCTTGTCGCAC # Questionable array : NO Score: 8.86 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : CTCTGTGTGAGTGCGTGGATTGAAAT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: R Score: 4.5/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:53.85%AT] # Reference repeat match prediction: R [matched CCCTGTGTGGGTGCGTGGATTGAAAC with 96% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [0.00,0.00] Score: 0/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [31.7-0.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.27,9 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 16-245 **** Predicted by CRISPRDetect 2.4 *** >NZ_NPBF01000144.1 Virgibacillus sp. 7505 contig00144, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ================================ ================================== ================== 16 32 93.8 34 ...........T...G................ GCGCCGGAACTTTGTGCAGCTGCCATGAACAAAG 82 32 100.0 34 ................................ CCACGTCTGTTATAAGTAGGAAGTACATATGCAG 148 32 100.0 34 ................................ TGATAACGGGTTAGACTATGAGTATAACTTAACA 214 32 100.0 0 ................................ | ========== ====== ====== ====== ================================ ================================== ================== 4 32 98.5 34 GTCGCACTCTTAGTGAGTGCGTGGATTGAAAT # Left flank : ATGATGAATCTGAATG # Right flank : TCGAAACTTTCGCCAGTAAGTACAGGTTTAGATTGTCGCACTCTTAGTGAG # Questionable array : NO Score: 8.79 # Score Detail : 1:0, 2:3, 3:3, 4:0.93, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACTCTTAGTGAGTGCGTGGATTGAAAT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: F Score: 4.5/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:53.12%AT] # Reference repeat match prediction: F [matched GTCGCACTCTTAGTGAGTGCGTGGATTGAAAT with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-3.40,-2.60] Score: 0.37/0.37 # Array degeneracy analysis prediction: R [2-0] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [18.3-48.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [9.37,0.68 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 15-244 **** Predicted by CRISPRDetect 2.4 *** >NZ_NPBF01000190.1 Virgibacillus sp. 7505 contig00190, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ================================ ==================================== ================== 15 32 96.9 33 ...........T.................... CACATTCACATTCTGAATATCTAACTGGTTGAC 80 32 100.0 36 ................................ AATTTTCATGTTCTCTTCCACTCCCTACCTTTTCGC 148 32 100.0 33 ................................ ATTCATGATTTCCTCCTATGCCGTTTTGATGGA 213 32 100.0 0 ................................ | ========== ====== ====== ====== ================================ ==================================== ================== 4 32 99.2 34 GTCGCACTCTTCGTGAGTGCGTGGATTGAAAT # Left flank : GTCTAGTCCGTAATG # Right flank : CGTTTGGTTGGTTCTTCATCTTTTCG # Questionable array : NO Score: 8.82 # Score Detail : 1:0, 2:3, 3:3, 4:0.96, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACTCTTCGTGAGTGCGTGGATTGAAAT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: F Score: 4.5/4.5 # A,T distribution in repeat prediction: R [6,10] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTCGCACTCTTCGTGAGTGCGTGGGTTGAAAT with 97% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-3.70,-2.60] Score: 0.37/0.37 # Array degeneracy analysis prediction: R [1-0] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [13.3-25.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [9.37,1.05 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 186-21 **** Predicted by CRISPRDetect 2.4 *** >NZ_NPBF01000260.1 Virgibacillus sp. 7505 contig00260, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ================================ =================================== ================== 185 32 100.0 34 ................................ TCTAATTGAGTTGTCCATTCTAAATTTTGAACTC 119 32 100.0 35 ................................ CCAGGGAATAACCGCCTATCTGATTGTTGCTTATT 52 32 100.0 0 ................................ | ========== ====== ====== ====== ================================ =================================== ================== 3 32 100.0 35 GTCGCACTCTATATGAGTGCGTGGATTGAAAT # Left flank : CTATATGAGTGCGTGGATTTAAATTACAGCCTCCTTTGTTTTTTGTTTATCTAGCTCT # Right flank : TTTTTTTAGCTCGGCCAATGT # Questionable array : NO Score: 8.67 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACTCTATATGAGTGCGTGGATTGAAAT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: R Score: 4.5/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:56.25%AT] # Reference repeat match prediction: R [matched GTCGCACTCTACATGAGTGCGTGGATTGAAAT with 97% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-2.60,-3.40] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [20.0-63.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,9.64 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 27-193 **** Predicted by CRISPRDetect 2.4 *** >NZ_NPBF01000538.1 Virgibacillus sp. 7505 contig00538, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ================================ ==================================== ================== 27 32 100.0 35 ................................ ATACAGGCGAAGGGGCTCCGGAAGCAACACTAGGG 94 32 100.0 36 ................................ TGATTTAACGGTCGTTAATGCCGCCCGTGTATCTTA 162 32 100.0 0 ................................ | ========== ====== ====== ====== ================================ ==================================== ================== 3 32 100.0 36 GTCGCACTCTTCGTGAGTGCGTGGATTGAAAT # Left flank : TTATTTGACTCGATCCTTTACGAGGCG # Right flank : CATTGTGGTT # Questionable array : NO Score: 8.67 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACTCTTCGTGAGTGCGTGGATTGAAAT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: F Score: 4.5/4.5 # A,T distribution in repeat prediction: R [6,10] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTCGCACTCTTCGTGAGTGCGTGGGTTGAAAT with 97% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-3.70,-2.60] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [25.0-10.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [9.64,0.37 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 63-696 **** Predicted by CRISPRDetect 2.4 *** >NZ_NPBF01000050.1 Virgibacillus sp. 7505 contig00050, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ================================ ===================================== ================== 63 32 100.0 35 ................................ AGAAGACGAGCAGTTTCCTAATACAAAAGATTTTG 130 32 100.0 35 ................................ CGCTTACGTTACAAAGATAAAACCACAGGGGAGTG 197 32 100.0 37 ................................ ACTCGTCAATCTGTGCCTGTAGTCCATCAAGGATATT 266 32 100.0 34 ................................ TAAACGACGAATAGGGTCTAGACTTGCGTTTGCT 332 32 100.0 34 ................................ ATCGTAGTTGGTGGCAGTATTATGACGCCCCTCC 398 32 100.0 35 ................................ CTTACCCGCCCCGGCACCTTTTCGCGTTCTAAATC 465 32 93.8 34 ..........TA.................... AGTAAATTTAGTTGGACGTTTGACAAAAGACCCA 531 32 93.8 34 ..........TA.................... TCAGGAATTTGGGCTACCCACAGCTTTGCCCCTC 597 32 90.6 36 .C........TA.................... GAAAGAACGATAACTTCATGTGTTCCAAACAGCAAC 665 32 93.8 0 ..........TA.................... | ========== ====== ====== ====== ================================ ===================================== ================== 10 32 97.2 35 GTCGCACTCTATGTGAGTGCGTGGATTGAAAT # Left flank : GGAAAGCGCGACTTTCCTATATTATCTGTGGTTTTATTTCCAGAAAATAGGGGAATTTCGCTG # Right flank : TTGCTTCCGGCGAACGGAATGTGGCTTTCTACTCGGCGCACTTTTTATAACTGCGCCAATTTAACAT # Questionable array : NO Score: 9.12 # Score Detail : 1:0, 2:3, 3:3, 4:0.86, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACTCTATGTGAGTGCGTGGATTGAAAT # Alternate repeat : GTCGCACTCTTAGTGAGTGCGTGGATTGAAAT # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: F Score: 4.5/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:53.12%AT] # Reference repeat match prediction: F [matched GTCGCACTCTTAGTGAGTGCGTGGATTGAAAT with 94% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-5.80,-2.60] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-5] Score: 0.41/0.41 # AT richness analysis in flanks prediction: F [63.3-50.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [10.05,0 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], //