Array 1 862-54 **** Predicted by CRISPRDetect 2.4 *** >NZ_NDXO01000144.1 Vibrio cholerae strain 102 contig00144, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 861 28 100.0 32 ............................ TTGTCTGTACTTTGCCCCGTGTCGCTTAGCGA 801 28 100.0 32 ............................ ATGACGATTGTTCGTGCCATTTCCTCATCAAT 741 28 100.0 32 ............................ GTATGGGCTCGCGAAGAACTAGGCGTCGGCTT 681 28 100.0 32 ............................ AGTTTGACGCTTTAACGCTAATTACATCCGGC 621 28 100.0 32 ............................ TTTAGGGCAAGCTATAATAATGTCGCTAACGC 561 28 100.0 32 ............................ TAGTTCTTCAATTGCGCTACCCATTCTTCTTG 501 28 100.0 32 ............................ TTGGTGTGAGAAGCGTCTAATCAACTCATTCT 441 28 100.0 32 ............................ TTCATGGAAGCAGCTAAAGTTGTTGGTAGTGA 381 28 100.0 32 ............................ GCCCATGCCGCCGCCTAGCGATTGAATATCAG 321 28 100.0 32 ............................ AGCAAACCAACGTTGCAGCGTTCCAAGGCATC 261 28 100.0 32 ............................ TGCCTTACATCAACGTGAACAAAGCCATGCTT 201 28 100.0 32 ............................ TTATTTGGCAGTCTTAGCAGCTCTTCTGGGCA 141 28 100.0 32 ............................ AGACTGTCGGGGGTGCATGATGATTGAAAACC 81 28 96.4 0 A........................... | ========== ====== ====== ====== ============================ ================================ ================== 14 28 99.7 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : CCGCACAGGCAGCTTAGAAAACCAGAAAGAAAGGCTAACTTTCCATCTCTC # Right flank : AAGTAATTGGCAGTTGTACTTTCTCTATCGCCAGTTCACTGCCGCACAGGCCAG # Questionable array : NO Score: 6.25 # Score Detail : 1:0, 2:3, 3:0, 4:0.99, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [5,8] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.70,-8.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: R [1-0] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [43.3-46.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,5.65 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 50-497 **** Predicted by CRISPRDetect 2.4 *** >NZ_NDXO01000199.1 Vibrio cholerae strain 102 contig00199, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 50 28 100.0 32 ............................ GGTTCGGCTTGCGCCGCAGGAACGGGGGTATT 110 28 100.0 32 ............................ TTACATGCTCGCAGCTTCAACTGTGATGCTTT 170 28 100.0 32 ............................ ATGATGCAACTGCGTATTCCATGTGCTGTTAT 230 28 100.0 32 ............................ TGAAGAAGTCCAGAAATGTAACTATCACCAGC 290 28 100.0 32 ............................ AAGAACTCATTAATGCAAGATTCGAGTTGGCG 350 28 100.0 32 ............................ ATAAGAGCGAAGTGTTGTTTGACTTTTCCGTA 410 28 96.4 32 ..................G......... TAATGGTTCTATTTTTATCGGGATGTGCAAGC 470 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 8 28 99.5 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : CACAGGCAGCTTAGAAAGTGGTACCGAGTAACTCACAGTCTCGTTTAACG # Right flank : ATGATAA # Questionable array : NO Score: 6.23 # Score Detail : 1:0, 2:3, 3:0, 4:0.97, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [8,5] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.00,-7.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: F [43.3-10.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.92,0 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 4-451 **** Predicted by CRISPRDetect 2.4 *** >NZ_NDXO01000203.1 Vibrio cholerae strain 102 contig00203, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 4 28 100.0 32 ............................ TCTAGTTCTTCTTCTGATAGCTCTGCCAGCTC 64 28 100.0 32 ............................ CAGTGGTCGTCCTCAAGCAATCCGCCCTTAAC 124 28 100.0 32 ............................ TTGAACAGATCGAGAACAACGTCGCCTTTTTT 184 28 100.0 32 ............................ TCACAGGTAACGCCTCTGGTGTTACTGCTGAT 244 28 100.0 32 ............................ TTGATCGACCAGTTTCTTTACCCAAACGTGGG 304 28 100.0 32 ............................ GATACGCTGCCCGACGCTTCTAATGACCTGCG 364 28 100.0 32 ............................ TTGTACCGTTACACTTTACCCTGCTTTCATCT 424 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 8 28 100.0 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : ATGG # Right flank : AAGCAAACAGACCTGCAAAAAGAACGTTAGATGTTC # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [8,5] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.00,-7.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [3.3-36.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.24,0.27 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 286-18 **** Predicted by CRISPRDetect 2.4 *** >NZ_NDXO01000245.1 Vibrio cholerae strain 102 contig00245, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 285 28 100.0 32 ............................ ACCAAGAAAAGCCAGCGTGATAAGCCATAGCA 225 28 100.0 32 ............................ GACTTTACAGCCCATGCGACAAGATAGCTCAC 165 28 100.0 32 ............................ CATTAGTTGATCTGCGCGTGGTACTTTGGCGC 105 28 100.0 32 ............................ AATTCGAACCCGTGGCGATAAACGCAACGATA 45 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 5 28 100.0 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : GGCAGCTTAGAAAAGTAATTGGCAGTTGTACTTTCTCTATCGCC # Right flank : ACCAAGCGTTATCACTAA # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [5,8] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.70,-8.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [16.7-43.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,5.51 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 50-256 **** Predicted by CRISPRDetect 2.4 *** >NZ_NDXO01000310.1 Vibrio cholerae strain 102 contig00310, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 50 28 100.0 32 ............................ CCAAGCGTTATCACTAACGGGGCGCGCCAGTT 110 28 100.0 32 ............................ TTAATAATAGCGGATACGTATTTCACTTGATG 170 28 100.0 32 ............................ TCTAGTTCTTCTTCTGATAGCTCTGCCAGCTC 230 27 96.4 0 ...........................- | ========== ====== ====== ====== ============================ ================================ ================== 4 28 99.1 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : CACAGGCAGCTTAGAAAAATTCGAACCCGTGGCGATAAACGCAACGATAG # Right flank : | # Questionable array : NO Score: 5.81 # Score Detail : 1:0, 2:3, 3:0, 4:0.95, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [7,5] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.00,-7.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [43.3-0.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.51,0 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 32-299 **** Predicted by CRISPRDetect 2.4 *** >NZ_NDXO01000247.1 Vibrio cholerae strain 102 contig00247, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 32 28 100.0 32 ............................ AAGCAAACAGACCTGCAAAAAGAACGTTAGAT 92 28 100.0 32 ............................ CAAAATAAACTGTGCGTTAAGCGCTGCTTGTT 152 28 100.0 32 ............................ TGATTACGAGCAGCGAGACGAACGTGAAGAAA 212 28 100.0 32 ............................ GGTGATCACTTTCATTGAAACAACCGAAATTT 272 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 5 28 100.0 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : TGTACCGTTACACTTTACCCTGCTTTCATCTG # Right flank : GCTCACCGACTACGTTGACCAAAAC # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [8,6] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-8.60,-9.10] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [28.3-20.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.28,0.37 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 250-42 **** Predicted by CRISPRDetect 2.4 *** >NZ_NDXO01000318.1 Vibrio cholerae strain 102 contig00318, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 249 28 100.0 32 ............................ GCTCACCGACTACGTTGACCAAAACCAGCAGC 189 28 100.0 32 ............................ TGAGCCTGAGCCTCAACCAGACCCAGAACATA 129 28 100.0 32 ............................ ACGGCCAAATCAAGACGAACTAGACGAGTAAT 69 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 4 28 100.0 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : | # Right flank : AGTGGTACCGAGTAACTCACAGTCTCGTTTAACGTTCACTGC # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [5,8] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.70,-8.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [35.0-0.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.27,5.24 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 48-195 **** Predicted by CRISPRDetect 2.4 *** >NZ_NDXO01000354.1 Vibrio cholerae strain 102 contig00354, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 48 28 100.0 32 ............................ GTAATGCCTGCAATTTGCGCGGCCCCTGTGTA 108 28 100.0 32 ............................ GAATTCAAAAGCCTTTTTTAATTTTTGTTGGT 168 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 3 28 100.0 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : CAGGCAGCTTAGAAAAGATCATGGAGAGGGAAGGGCTCAACGCTGATG # Right flank : ACCAGAAAGAAAGGCTAACTTTCCATCTCTCAGTTC # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [8,5] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.00,-7.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [38.3-33.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.65,0 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 48-315 **** Predicted by CRISPRDetect 2.4 *** >NZ_NDXO01000054.1 Vibrio cholerae strain 102 contig00054, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 48 28 100.0 32 ............................ TTATCGTTGGAATTATTCAGAAGTTGAAACCC 108 28 100.0 32 ............................ TGCGCATGAGTTTGGTGATGGAACTATGCAAA 168 28 96.4 32 ...........T................ AAGCCAACGGATTACACGACCGAAGACGTGAC 228 28 96.4 32 ...........T................ GCTTGGTTTGACCAACTCGGCGGCGCATCGCT 288 28 92.9 0 .........................TT. | ========== ====== ====== ====== ============================ ================================ ================== 5 28 97.1 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : CAGGCAGCTTAGAAAATGATAAGTGCTGGGTCACCACGAAGTAGTAAG # Right flank : AGAAAGTGAACCAAACGATGCAGTTCACTTTCAACATTTTAATGAGGTTCCTACTTTATATTGTGCATATTCATTATGACCTGCCTAATGGTGCTTTCGATATCAGGAGTCACCTCTTTTCGAGGTGTTGCGAGTTTTTTCAAGAGTTCTGCCTGGCGGTAGTCGGAAACATCACCATAGCTGTAAAAAGTAGTCAGTACGCCTTCATGACCTAAGTTTTGGCTCCAAGCTTTAAACTCTTCCGCGTTGCTACATAATTGCTCCCCTAAACGAGCTAGTGTGTTGCGAAAGCTATGTGGGTTGTAATAAGGCAATCCTGCTAGTTTGAAACTTTGCTTGAAGATTCTTCTGATTGGGTTTGCTGTTGTCCAATGCTCTTTTGTTAATCCCATGGCTTCAAACTGAAAGTTGGGGCTGTTCTTCACTTTCGTTTTTGGGAAAAGGGGAGCTTCTGGGCCGAATGAAAGCTCATTTGTTAGATAACTCACCCATTCGGTAAC # Questionable array : NO Score: 5.83 # Score Detail : 1:0, 2:3, 3:0, 4:0.85, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:0.92, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : GTTCACTGCCGTACAGGCAGCTTAGAAA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [8,5] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.00,-7.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-2] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [43.3-66.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.65,0.27 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 157-9 **** Predicted by CRISPRDetect 2.4 *** >NZ_NDXO01000093.1 Vibrio cholerae strain 102 contig00093, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 156 28 100.0 32 ............................ AGATCATGGAGAGGGAAGGGCTCAACGCTGAT 96 28 100.0 32 ............................ GTAATGCCTGCAATTTGCGCGGCCCCTGTGTA 36 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 3 28 100.0 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : GATGTAACTTACGTAAGCTTTGTACGCAAGCAGGTGAAATCGCCAGAACGAATAGAGCGGGATATGCAGCAAAAAGCCGCACTATGGGCAGAAAAATCCGGCAAACCGCTGGTGGAATGTTTAGTGGATTTGCAACAAAGCAAGCCGACAGCGTTGTGCTCCTTGCCCTTTATTTACTTGCATAGCCAGCAAACCAAGCAACGCTCACCAGAAAAAAACAGCAAGTTCCCGCTGTTTATTCAGATGCAGCCGCAAAGCACATCACAAGATGGGGACTTCGATTGCTATGGCTTGAGTAGCAAAGCGAATGGACAATCAGCATTGGCTACCGTACCGCACTTTTAAATTGAACGAAAAAGGGTAGTTTTTGCCCTTTATTTTTGCTCTTTAAAAATGTGTTTTAAAAACAAATAGTTGCAACCGGTTGTTTTTAATAAGGTAAAAAGATGTTTTTTACCCTAACAGCCTGTTGCAGCTTATTTTTATCGGTTTATTCTATT # Right flank : AGAATTCAA # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [5,8] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.70,-8.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [10.0-70.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,5.51 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], //