Array 1 320-20 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBKK01000011.1 Streptococcus agalactiae strain ES-NI-013 NODE_1_length_277315_cov_117.991_ID_1, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 319 36 100.0 30 .................................... CATGCTTGCTGTTGTAAATTGCCCGACTGT 253 36 100.0 30 .................................... ATCAACTGCTAGATACGATAACACGACAAC 187 36 100.0 30 .................................... TACCACCTGATGGATTATCAAGTGATAAAT 121 36 100.0 30 .................................... TTCTTTAATACCTGAAATCATTGCGTTGTA 55 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 5 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : CGAAAAGCCAGAAGTGAAATCAATGGTAGAAAAATTAGCAGCTACTATTACAGAACTTATCGCATTTGAGTGTCTAGAGAATGAGCTTGATTTAGAATACGATGAAATTACGATTTTAGAACTCATTAAGGCACTGGGAGTCAAAATTGAGACACAGAGCGACACTATCTTTGAAAAATGTTTTGAAATTATACAAGTTTACCATTATTTAACGAAAAAGAATCTCTTGGTTTTTGTTAATAGCGGAGCTTATCTTACCAAAGATGAAGTTATAAAATTATGTGAATACATCAATTTAATGCAAAAGTCAGTACTCTTTCTAGAACCTAGAAGACTCTATGATTTACCGCAATATGTTATTGATAAGGATTATTTCTTGATAGGCGAAAATATGGTATAATATTAGTAAAAGCACAGTAATAACAAGGAATCATCGAAACTGAAGTCCTGCTGAGACGAATGGCGCGATTACGAAAGCTCAAAAGAAAATTTTCTACGAG # Right flank : CTTGTAATATTTGGTAACTC # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [23.3-56.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,5.14 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 20-715 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBKK01000030.1 Streptococcus agalactiae strain ES-NI-013 NODE_37_length_734_cov_437.987_ID_73, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 20 36 100.0 30 .................................... CATGCTTGCTGTTGTAAATTGCCCGACTGT 86 36 100.0 30 .................................... ATCAACTGCTAGATACGATAACACGACAAC 152 36 100.0 30 .................................... TACCACCTGATGGATTATCAAGTGATAAAT 218 36 100.0 30 .................................... TTGTAATATTTGGTAACTCTTCTTTTGTTA 284 36 100.0 30 .................................... TGCGACCATGTCAGTCCAACGGTATTTTGT 350 36 100.0 30 .................................... TTCTTTAATACCTGAAATCATTGCGTTGTA 416 36 100.0 30 .................................... TTGTAATATTTGGTAACTCTTCTTTTGTTA 482 36 100.0 30 .................................... TCCGACCATGTCAGTCCAACGGTATTTTGT 548 36 100.0 30 .................................... TTCTTTAATACCTGAAATCATTGCGTTGTA 614 36 100.0 30 .................................... TTGTAATATTTGGTAACTCTTCTTTTGTTA 680 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 11 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : AAAGAAAATTTTCTACGAGG # Right flank : TCCGACCATGTCAGTCCAC # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:59.46%AT] # Reference repeat match prediction: F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-4.70,-0.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: R [2-0] Score: 0.41/0.41 # AT richness analysis in flanks prediction: F [23.3-11.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.14,0.41 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 386-20 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBKK01000042.1 Streptococcus agalactiae strain ES-NI-013 NODE_48_length_404_cov_370.756_ID_95, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 385 36 100.0 30 .................................... CATGCTTGCTGTTGTAAATTGCCCGACTGT 319 36 100.0 30 .................................... ATCAACTGCTAGATACGATAACACGACAAC 253 36 100.0 30 .................................... TTGTAATATTTGGTAACTCTTCTTTTGTTA 187 36 100.0 30 .................................... TCCGACCATGTCAGTCCAACGGTATTTTGT 121 36 100.0 30 .................................... TTCTTTAATACCTGAAATCATTGCGTTGTA 55 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 6 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : TAAGAAAATTTTCTACGA # Right flank : CTTGTAATATTTGGTAACTC # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [23.3-23.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.87 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 20-187 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBKK01000058.1 Streptococcus agalactiae strain ES-NI-013 NODE_62_length_206_cov_208.682_ID_123, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 20 36 100.0 30 .................................... CATGCTTGCTGTTGTAAATTGCCCGACTGT 86 36 100.0 30 .................................... ATCAACTGCTAGATACGATAACACGACAAC 152 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 3 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : AAAGAAAATTTTCTACGAGG # Right flank : TCCGACCATGTCAGTCCAA # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-4.70,-0.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [23.3-15.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.87,0 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], //