Array 1 277086-277451 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBLD01000011.1 Streptococcus agalactiae strain IT-PW-075 NODE_1_length_277492_cov_64.0207_ID_1, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 277086 36 100.0 30 .................................... GTTGATCTTATTCACGTTTCGTGAAGTTTA 277152 36 100.0 30 .................................... CAGAAAAAATCATGGCGAGAGCCTTGCTCA 277218 36 100.0 30 .................................... ATTAATATTGGTCAGAATAAGCTATTTCAG 277284 36 100.0 30 .................................... ACGATGTTTGTGAAAGACAAAATCTTCGCT 277350 36 100.0 30 .................................... TTACCGAAAGAGTGGAAAAACTACTCAGTG 277416 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 6 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : CGAAAAGCCAGAAGTGAAATCAATGGTAGAAAAATTAGCAGCTACTATTACAGAACTTATCGCATTTGAGTGTCTAGAGAATGAGCTTGATTTAGAATACGATGAAATTACGATTTTAGAACTCATTAAGGCACTGGGAGTCAAAATTGAGACACAGAGCGACACTATCTTTGAAAAATGTTTTGAAATTATACAAGTTTACCATTATTTAACGAAAAAGAATCTCTTGGTTTTTGTTAATAGCGGAGCTTATCTTACCAAAGATGAAGTTATAAAATTATGTGAATACATCAATTTAATGCAAAAGTCAGTACTCTTTCTAGAACCTAGAAGACTCTATGATTTACCGCAATATGTTATTGATAAGGATTATTTCTTGATAGGCGAAAATATGGTATAATATTAGTAAAAGCACAGTAATAACAAGGAATCATCGAAACTGAAGTCCTGCTGAGACGAATGGCGCGATTACGAAAGCTCAAAAGAAAATTTTCTACGAG # Right flank : AGCGGATGTCAATAGATTTCTACGAACAAGGTTTTAGAGAA # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-4.70,-0.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [56.7-43.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.14,0 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 44033-43733 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBLD01000012.1 Streptococcus agalactiae strain IT-PW-075 NODE_20_length_44073_cov_61.0506_ID_39, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 44032 36 100.0 30 .................................... TTGTAATATTTGGTAACTCTTCTTTTGTTA 43966 36 100.0 30 .................................... TTTTTACCAATGCTTCCATATCGCTTATAT 43900 36 100.0 30 .................................... TACTTGACGAATTGAAGATGACGGAATTTA 43834 36 100.0 30 .................................... TGGTTATACATTTACTAATCCATCAGCATT 43768 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 5 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : CATTCCAAAACTTCTTTAATACCTGAAATCATTGCGTTGT # Right flank : AAGCTAATTCTCATCTCACCGAGATGGATAGTTTTAGAGCTGTGCTGTTATTATGCTAGGACATCATTGTGGTGTTCTAGTTTTTTGTTATACTGAAATAAATTTTCAGAGAATGTGGGGGAAGGCGGTAATTAGATTAATTCAAGACGTAATTCAGAACTTAGTTGGCCAAGCTAACGAAATCACCCCAATTTATCAGTTTGATTGGGAAACTTATATATTGGCGACTAAAAAATATGAACGTCATTTAGAGGTGTGTCTATTAGTAGAAAATTCGAATTGTTTTTCGGATTCAAAGAGAATGTGTCAATAAAAGAGATATGAAAGGCTATAATTCCAACCTTATGGTTAAAGGGCTAGGTTGTTCTACGCTTTACTTAATTATTAGTTTGACAGCGTTGGTTCTTTTAGTGATTGCTGGTGTTTTCTTTGTCATTAATACTTGCAAGCTTACAAGGAAAGCAGTGGAGAACCTATCCATAATCAACTAACAGCTATGA # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:60.53%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: R [2-0] Score: 0.41/0.41 # AT richness analysis in flanks prediction: F [60.0-45.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.27,5.28 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 499-1 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBLD01000029.1 Streptococcus agalactiae strain IT-PW-075 NODE_36_length_539_cov_51.0433_ID_71, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 498 36 100.0 30 .................................... CATGCTTGCTGTTGTAAATTGCCCGACTGT 432 36 100.0 30 .................................... ATCAACTGCTAGATACGATAACACGACAAC 366 36 100.0 30 .................................... TACCACCTGATGGATTATCAAGTGATAAAT 300 36 100.0 30 .................................... TAACTTTAATTCGATTATGTTTTGGTTATC 234 36 100.0 30 .................................... GTAAGTATTTTAAACGTGACTATTCCTGAA 168 36 100.0 30 .................................... TTTTTATTATGGAAAGTAATCATTATTTTT 102 36 100.0 30 .................................... TTCTTTAATACCTGAAATCATTGCGTTGTA 36 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 8 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : GGTTCCAAAACAGCGGATGTCAATAGATTTCTACGAACAA # Right flank : C # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [0.0-40.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,5.14 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 540-42 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBLD01000028.1 Streptococcus agalactiae strain IT-PW-075 NODE_35_length_579_cov_60.3068_ID_69, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 539 36 100.0 30 .................................... ATCCATTCCTACAGGAATCACTCAAAATAT 473 36 100.0 30 .................................... AGCGGATGTCAATAGATTTCTACGAACAAG 407 36 100.0 30 .................................... AGCGGATGTCAATAGATTTCTACGAACAAG 341 36 100.0 30 .................................... CAAGAATTATAGTAGGTTATTAAAGTTAAT 275 36 100.0 30 .................................... CATGCTTGCTGTTGTAAATTGCCCGACTGT 209 36 100.0 30 .................................... ATCAACTGCTAGATACGATAACACGACAAC 143 36 100.0 30 .................................... TACCACCTGATGGATTATCAAGTGATAAAT 77 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 8 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : GTTCCAAAACTTACCGAAAGAGTGGAAAAACTACTCAGT # Right flank : CGTAAGTATTTTAAACGTGACTATTCCTGAAGTTTTAGAGCT # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [46.7-40.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.87 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 473-41 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBLD01000031.1 Streptococcus agalactiae strain IT-PW-075 NODE_38_length_472_cov_50.6051_ID_75, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 472 36 100.0 30 .................................... CATGCTTGCTGTTGTAAATTGCCCGACTGT 406 36 100.0 30 .................................... ATCAACTGCTAGATACGATAACACGACAAC 340 36 100.0 30 .................................... TACCACCTGATGGATTATCAAGTGATAAAT 274 36 100.0 30 .................................... TAACTTTAATTCGATTATGTTTTGGTTATC 208 36 100.0 30 .................................... GTAAGTATTTTAAACGTGACTATTCCTGAA 142 36 100.0 30 .................................... TTTTTATTATGGAAAGTAATCATTATTTTT 76 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 7 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : | # Right flank : CTTCTTTAATACCTGAAATCATTGCGTTGTAGTTTTAGAGC # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [45.0-0.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.27,4.87 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 42-473 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBLD01000030.1 Streptococcus agalactiae strain IT-PW-075 NODE_37_length_474_cov_78.2972_ID_73, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 42 36 100.0 30 .................................... GTTGATCTTATTCACGTTTCGTGAAGTTTA 108 36 100.0 30 .................................... GTTGATCTTATTCACGTTTCGTGAAGTTTA 174 36 100.0 30 .................................... CAGAAAAAATCATGGCGAGAGCCTTGCTCA 240 36 100.0 30 .................................... ATTAATATTGGTCAGAATAAGCTATTTCAG 306 36 100.0 30 .................................... GATATTTGGAAAGATTCTGATTTTGGTAAG 372 36 100.0 30 .................................... TTACCGAAAGAGTGGAAAAACTACTCAGTG 438 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 7 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : GGTTCCAAAACGTTGATCTTATTCACGTTTCGTGAAGTTTAG # Right flank : A # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-4.70,-0.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [43.3-1.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.14,0 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 408-42 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBLD01000032.1 Streptococcus agalactiae strain IT-PW-075 NODE_39_length_448_cov_58.5768_ID_77, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 407 36 100.0 30 .................................... AGGGAGGAGAGAATCAATGCCGAATGCTGA 341 36 100.0 30 .................................... TGGCGAAAAATGGTATTATCTCAAAGGCAA 275 36 100.0 30 .................................... TTTTTACCAATGCTTCCATATCGCTTATAT 209 36 100.0 30 .................................... TACTTGACGAATTGAAGATGACGGAATTTA 143 36 100.0 30 .................................... TGGTTATACATTTACTAATCCATCAGCATT 77 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 6 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : GGTTCCAAAACTTCTTTAATACCTGAAATCATTGCGTTGT # Right flank : CAAGCTAATTCTCATCTCACCGAGATGGATAGTTTTAGAGCT # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [41.7-45.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.87 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 341-41 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBLD01000036.1 Streptococcus agalactiae strain IT-PW-075 NODE_42_length_380_cov_47.0165_ID_83, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 340 36 100.0 30 .................................... TTGTAATATTTGGTAACTCTTCTTTTGTTA 274 36 100.0 30 .................................... TCCGACCATGTCAGTCCAACGGTATTTTGT 208 36 100.0 30 .................................... TTCTTTAATACCTGAAATCATTGCGTTGTA 142 36 100.0 30 .................................... TGGCGAAAAATGGTATTATCTCAAAGGCAA 76 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 5 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : GTTCCAAAACTTCTTTAATACCTGAAATCATTGCGTTGT # Right flank : CTTTTTACCAATGCTTCCATATCGCTTATATGTTTTAGAGC # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:60.53%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [43.3-43.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.87 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 235-1 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBLD01000040.1 Streptococcus agalactiae strain IT-PW-075 NODE_46_length_234_cov_62.5096_ID_91, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 234 36 100.0 30 .................................... CATGCTTGCTGTTGTAAATTGCCCGACTGT 168 36 100.0 30 .................................... ATCAACTGCTAGATACGATAACACGACAAC 102 36 100.0 30 .................................... TACCACCTGATGGATTATCAAGTGATAAAT 36 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 4 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : | # Right flank : C # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [0.0-0.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.87 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 1-168 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBLD01000045.1 Streptococcus agalactiae strain IT-PW-075 NODE_50_length_208_cov_39.9924_ID_99, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 1 36 100.0 30 .................................... GTAAGTATTTTAAACGTGACTATTCCTGAA 67 36 100.0 30 .................................... TTTTTATTATGGAAAGTAATCATTATTTTT 133 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 3 36 100.0 35 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : | # Right flank : TTCTTTAATACCTGAAATCATTGCGTTGTAGTTTTGTCGC # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-4.70,-0.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [0.0-43.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.87,0.27 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 210-42 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBLD01000043.1 Streptococcus agalactiae strain IT-PW-075 NODE_49_length_210_cov_37.3158_ID_97, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 209 36 97.2 30 ..C................................. TTTTTACCAATGCTTCCATATCGCTTATAT 143 36 100.0 30 .................................... TACTTGACGAATTGAAGATGACGGAATTTA 77 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 3 36 99.1 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : | # Right flank : CAAGCTAATTCTCATCTCACCGAGATGGATAGTTTTAGAGCT # Questionable array : NO Score: 5.31 # Score Detail : 1:0, 2:3, 3:0, 4:0.95, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:0.69, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: F [41.7-1.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.68,4.87 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], //