Array 1 450-18 **** Predicted by CRISPRDetect 2.4 *** >NZ_FJSC01000004.1 Streptococcus agalactiae isolate VSA36, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 449 36 100.0 30 .................................... TTTTTGCGTTTGTAAGTTTCAATCCCATAG 383 36 100.0 30 .................................... CAGAAGCTATTACGCAATATATGTCATACT 317 36 100.0 30 .................................... ATGGCAATACAATCCTTATCGAGGTTCCAG 251 36 100.0 30 .................................... ACCACTTTCAAGAGAAACAGGCGGACTTGA 185 36 100.0 30 .................................... GACAGTAAAAGAATACAATTTAAGGATTAA 119 36 100.0 30 .................................... GAATACAGGCGGTTAAGACTGCGCAGAGGG 53 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 7 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : CGAAAAGCCAGAAGTGAAATCAATGGTAGAAAAATTAGCAGCTACTATTACAGAACTTATCGCATTTGAGTGTCTAGAGAATGAGCTTGATTTAGAATACGATGAAATTACGATTTTAGAACTCATTAAGGCACTGGGAGTCAAAATTGAGACACAGAGCGACACTATCTTTGAAAAATGTTTTGAAATTATACAAGTTTACCATTATTTAACGAAAAAGAATCTCTTGGTTTTTGTTAATAGCGGAGCTTATCTTACCAAAGATGAAGTTATAAAATTATGTGAATACATCAATTTAATGCAAAAGTCAGTACTCTTTCTAGAACCTAGAAGACTCTATGATTTACCGCAATATGTTATTGATAAGGATTATTTCTTGATAGGCGAAAATATGGTATAATATTAGTAAAAGCACAGTAATAACAAGGAATCATCGAAACTGAAGTCCTGCTGAGACGAATGGCGCGATTACGAAAGCTCAAAAGAAAATTTTCTACGAG # Right flank : CACTCGATTTGTAAAAAA # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [21.7-56.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,5.14 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 253-19 **** Predicted by CRISPRDetect 2.4 *** >NZ_FJSC01000124.1 Streptococcus agalactiae isolate VSA36, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 252 36 100.0 30 .................................... TTTTCAAAAGATAAAACATTTAAAAGACTA 186 36 100.0 30 .................................... CATTTTTTGTAATTCTTCAACATTGTGACA 120 36 100.0 30 .................................... AAAGACTTAATAAAGAATTTGACAATGATC 54 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 4 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : GAAGATGACGGAATTT # Right flank : CTACTTGACGAATTGAAGA # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [20.0-18.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.87 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 18-185 **** Predicted by CRISPRDetect 2.4 *** >NZ_FJSC01000120.1 Streptococcus agalactiae isolate VSA36, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 18 36 100.0 30 .................................... TTTAGCGCTTATGTTAAACGTGAGGTAGCT 84 36 100.0 30 .................................... AAACGTTAAAGTCTTTAACGTCGTCTAACG 150 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 3 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : AAAACCTTGGCTGATAAG # Right flank : ACTCGATTTGTAAAAAA # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-4.70,-0.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [18.3-21.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.87,0 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], //