Array 1 203-1 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_VKSE01000572.1 Escherichia coli strain AS012491 AS012491_574, whole genome shotgun sequence		Array_Orientation: Reverse

  Position	Repeat	   %id	Spacer	Repeat_Sequence              	Spacer_Sequence                 	Insertion/Deletion
==========	======	======	======	=============================	================================	==================
       202	    25	  79.3	    32	----......................CG.	CACGAAATGCCTGATAATTTGACGGTGACCGG	
       145	    29	  89.7	    32	..........................GAA	TGGCTGCAGCGGGCCAAGGAGGCCAAGGCCGG	
        84	    29	 100.0	    32	.............................	GCCAGAATGTCCTGCGCCTGCGCCTCGGCCGG	
        23	    23	  79.3	     0	.......................------	|                               	
==========	======	======	======	=============================	================================	==================
         4	    29	  87.1	    32	TTCATCCCCGCGCAGGCGGGGCACACTTC	                                	       

# Left flank :   |
# Right flank :  A

# Questionable array : NO	 Score: 3.40
# 	Score Detail : 1:0, 2:3, 3:0, 4:0.35, 5:-1.5, 6:0.25, 7:0.01, 8:0.6, 9:0.69,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     TTCATCCCCGCGCAGGCGGGGCACACTTC
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     R [1,2] Score: 0.37/0.37
# 	Reference repeat match prediction:         R [matched GTTCTCCCCGCGCAGGCGGGGGTGGTCCG with 100% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  R [0.00,-1.60] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      NA [0-0] Score: 0/0.41
# 	AT richness analysis in flanks prediction: NA [0.0-0.0]%AT Score: 0/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         R [0,5.24   Confidence: HIGH] 

# Array family : I-E [Matched known repeat from this family],   
//


Array 1 28-178 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_VKSE01000515.1 Escherichia coli strain AS012491 AS012491_517, whole genome shotgun sequence		Array_Orientation: Forward

  Position	Repeat	   %id	Spacer	Repeat_Sequence              	Spacer_Sequence                 	Insertion/Deletion
==========	======	======	======	=============================	================================	==================
        28	    29	 100.0	    32	.............................	CAGCCCGACTGGTTCAAGGGCCCCTGGCCGTG	
        89	    29	 100.0	    32	.............................	CTCTACCACGTGGCGACCGTTCCGACGTCCGG	
       150	    29	 100.0	     0	.............................	|                               	
==========	======	======	======	=============================	================================	==================
         3	    29	 100.0	    32	GTGTGCCCCGCCTGCGCGGGGATGAACCG	                                	       

# Left flank :   GCGACGCGCCCCTCCGCGATCATCCCGG
# Right flank :  GCCCAGGGCGGCGTCGAAACAGTGACGATCCCGTG

# Questionable array : NO	 Score: 5.67
# 	Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTGTGCCCCGCCTGCGCGGGGATGAACCG
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     R [3,4] Score: 0.37/0.37
# 	Reference repeat match prediction:         F [matched GTGTTCCCCGCCTGCGCGGGGATGAACCG with 97% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  R [-12.50,-13.00] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      F [0-1] Score: 0.41/0.41
# 	AT richness analysis in flanks prediction: NA [10.0-18.3]%AT Score: 0/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         F [4.91,0.74   Confidence: HIGH] 

# Array family : I-E [Matched known repeat from this family],   
//