Array 1 432-3 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_AQOJ01000254.1 Xanthomonas sp. SHU 166 254, whole genome shotgun sequence		Array_Orientation: Reverse

  Position	Repeat	   %id	Spacer	Repeat_Sequence                	Spacer_Sequence                     	Insertion/Deletion
==========	======	======	======	===============================	====================================	==================
       431	    31	  96.8	    35	.......................A.......	TTCTCGCCCGATATCCGGTACGTGCGCGAGAGCAT 	
       365	    31	 100.0	    35	...............................	CTGTACACGGCAATGCGCATGGCCGGCGCGCTTGC 	
       299	    31	 100.0	    36	...............................	AGCAGCATCACGGCCGGTCTGGATGGCGGCACCATC	
       232	    31	 100.0	    35	...............................	GCATAACGCATGCAAGCGGAGTAGGCCTCACCCTG 	
       166	    31	  96.8	    35	..............................T	ATGCAGCCCTCCGCGCCGGCGCCGGCTGCGTGCCC 	
       100	    31	 100.0	    36	...............................	GTCGGTGTCGACGAACTTGAGGCGGTCCAGCTGGTC	
        33	    31	  96.8	     0	.......................A.......	|                                   	
==========	======	======	======	===============================	====================================	==================
         7	    31	  98.6	    36	GTCGCACCCTCACGGGTGCGTGGGTTGAAAC	                                    	       

# Left flank :   |
# Right flank :  CTT

# Questionable array : NO	 Score: 6.19
# 	Score Detail : 1:0, 2:3, 3:0, 4:0.93, 5:0, 6:0.25, 7:0.01, 8:1, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTCGCACCCTCACGGGTGCGTGGGTTGAAAC
# Alternate repeat :   GTCGCACCCTCACGGGTGCGTGGATTGAAAC

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     F [6,5] Score: 0.37/0.37
# 	Reference repeat match prediction:         R [matched GTCGCACCCTCACGGGTGCGTGGATTGAAAC with 97% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  NA [-7.90,-7.90] Score: 0/0.37
# 	Array degeneracy analysis prediction:      NA [1-1] Score: 0/0.41
# 	AT richness analysis in flanks prediction: NA [3.3-0.0]%AT Score: 0/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         R [0.37,4.5   Confidence: HIGH] 

# Array family : I-C [Matched known repeat from this family],   
//


Array 1 426-1 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_AQOJ01000366.1 Xanthomonas sp. SHU 166 366, whole genome shotgun sequence		Array_Orientation: Reverse

  Position	Repeat	   %id	Spacer	Repeat_Sequence                	Spacer_Sequence                      	Insertion/Deletion
==========	======	======	======	===============================	=====================================	==================
       425	    31	 100.0	    34	...............................	ATGGCCATCACTCCCTTTGTGTGTAGCCATTATA   	
       360	    31	 100.0	    35	...............................	CAGCAGTGTGATCTACCTGCGGGACGTGCTGCGTC  	
       294	    31	 100.0	    37	...............................	CGTAGCTGGCCAGGCACCTATCGAAATGCAGTCCGCC	
       226	    31	 100.0	    34	...............................	TGCTGGTAGTCCTCATCCGAGTCCATCATCACCA   	
       161	    31	 100.0	    34	...............................	TGGATCAGCTGGCAGAGCTGGCCGGCTTCCTCGG   	
        96	    31	 100.0	    35	...............................	GTCAAGCAGGACGTGGCGGCCGAGAAGGCGTGGCA  	
        30	    30	  96.8	     0	..............................-	|                                    	
==========	======	======	======	===============================	=====================================	==================
         7	    31	  99.5	    35	GTCGCGCCCTCACGGGCGCGTGGATTGAAAC	                                     	       

# Left flank :   C
# Right flank :  A

# Questionable array : NO	 Score: 9.23
# 	Score Detail : 1:0, 2:3, 3:3, 4:0.97, 5:0, 6:0.25, 7:0.01, 8:1, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTCGCGCCCTCACGGGCGCGTGGATTGAAAC
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         R Score: 4.5/4.5
# 	A,T distribution in repeat prediction:     NA [5,5] Score: 0.37/0.37
# 	Reference repeat match prediction:         R [matched GTCGCGCCCTCACGGGCGCGTGGATTGAAAC with 100% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  F [-7.80,-7.20] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      R [1-0] Score: 0.41/0.41
# 	AT richness analysis in flanks prediction: NA [0.0-1.7]%AT Score: 0/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         R [0.37,9.41   Confidence: HIGH] 

# Array family : I-C [Matched known repeat from this family],   
//