Array 1 38687-38893 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_AGTS01000032.1 Acidovorax sp. NO-1 contig34, whole genome shotgun sequence		Array_Orientation: Forward

  Position	Repeat	   %id	Spacer	Repeat_Sequence             	Spacer_Sequence                  	Insertion/Deletion
==========	======	======	======	============================	=================================	==================
     38687	    28	 100.0	    33	............................	TGCCCAGGTAGTCCTTTGCCTCGCGGATGGCCT	
     38748	    23	  78.6	     0	..A....................-----	-                                	Deletion [38771]
     38771	    27	  64.3	     9	..-.............C.A.CTGC.GGG	CACACATCA                        	G,T [38778,38782]
     38809	    28	  96.4	    33	....................A.......	TCTCACGCCTTGCGTCCTCTCTCTGCGCTCCAC	
     38870	    24	  85.7	     0	........................----	|                                	
==========	======	======	======	============================	=================================	==================
         5	    28	  85.0	    19	GTCTTCCCCACGCCCGTGGGGGTGTTTC	                                 	       

# Left flank :   TGTACAAGGAGGAGCTGTGCATTGACCTCGCCTTTGCCCTCACCCGCGATTTGGCGGGCCGCTACGACAAGCACAAAGTGGCGGCACGGTTCAGGCAGCGGGTGATCGACATGGACTTGCTGGCCAAGGTGGGCGAGGACGTGATTGCCATGCTGGGGACGGGCCGTGCTCATCGTTATCGCAAATGATCTGCCACCCGCCGTGCGCGGGCGCATGAAGCTGTGGTTCATTGAACCCAGGCCCAACGTGTTTGTCTCCGGCATCAAAGACTCGGTGGCCACCACGGTGGTGGAGTACCTTTACCAGCATTGCCCGCCAGAGTCTGGCGTGCTGCTGATCAAGTCTATTTCCCACGCCCCGGGATTTGAAATCCGCACCATTGGCCCGCCACGCAAGCCCACCATTCAGATTTCGGGATTGGAGCTGATCATCGAAACCCTTAAATCGGGTTAACACACTACCGGTAGTGTTTTCGGCGTTCCTAGACACTACCTGTCAGG
# Right flank :  TT

# Questionable array : NO	 Score: 2.88
# 	Score Detail : 1:0, 2:3, 3:0, 4:0.25, 5:0, 6:0.25, 7:-1.53, 8:0.4, 9:0.51,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTCTTCCCCACGCCCGTGGGGGTGTTTC
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     R [1,5] Score: 0.37/0.37
# 	Reference repeat match prediction:         F [matched GTCTTCCCCACGCCCGTGGGGGTGTTTC with 100% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  R [-0.90,-1.60] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      NA [1-1] Score: 0/0.41
# 	AT richness analysis in flanks prediction: F [51.7-3.3]%AT Score: 0.27/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         F [4.77,0.74   Confidence: HIGH] 

# Array family : I-E [Matched known repeat from this family],   
//


Array 1 52-383 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_AGTS01000018.1 Acidovorax sp. NO-1 contig19, whole genome shotgun sequence		Array_Orientation: Forward

  Position	Repeat	   %id	Spacer	Repeat_Sequence             	Spacer_Sequence                  	Insertion/Deletion
==========	======	======	======	============================	=================================	==================
        52	    28	 100.0	    33	............................	CGTGCCCTTCTTTTCGCCGTAGGTGTGGCGTTC	
       113	    28	 100.0	    32	............................	GCCGGGTGGTGACGCAATCGCTACGCGGGAGG 	
       173	    28	 100.0	    33	............................	CAGTCGGCAGTGCCTGCGCAGCAGCCCCACGGC	
       234	    28	 100.0	    33	............................	TACTCGGGTGACTTGTGCAGCCCCAGCTTTGCC	
       295	    28	 100.0	    33	............................	CGCGTCTGCGGTGTTCAGCGGCCTGCAGGGCAA	
       356	    28	 100.0	     0	............................	|                                	
==========	======	======	======	============================	=================================	==================
         6	    28	 100.0	    33	GTCTTCCCCACGCCCGTGGGGGTGTTTC	                                 	       

# Left flank :   CGCCCGTGGGGGTGTTTCCTTCGGCGGCTCGCGGCAAGGTGTGATTGAAGCG
# Right flank :  CGGGGGCGCTCACGAAGCCTACATG

# Questionable array : NO	 Score: 6.26
# 	Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTCTTCCCCACGCCCGTGGGGGTGTTTC
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     R [1,8] Score: 0.37/0.37
# 	Reference repeat match prediction:         F [matched GTCTTCCCCACGCCCGTGGGGGTGTTTC with 100% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  F [-11.50,-10.80] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      NA [0-0] Score: 0/0.41
# 	AT richness analysis in flanks prediction: F [28.3-13.3]%AT Score: 0.27/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         F [5.14,0.37   Confidence: HIGH] 

# Array family : I-E [Matched known repeat from this family],   
//