Array 1 1-565 **** Predicted by CRISPRDetect 2.4 *** >NZ_QDBI01000018.1 Listeria monocytogenes strain ICDC_LM1233 LM1233Scaffold17_1, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== =============================== ================== 1 36 100.0 30 .................................... GAACTTCTTCACCATCCTTCATTTCTGTTT 67 36 100.0 30 .................................... TCAGACTTCTATATCCACAATAAAAGCCCT 133 36 100.0 30 .................................... GCGAGTCAATTCATCAAACCCAATCAGAAA 199 36 100.0 30 .................................... GTGTACACGATAGTCCAAGTCGGTATTTCC 265 36 100.0 31 .................................... CTCACGTTGTCAAGGTCAAATTTTAGATATG 332 36 100.0 30 .................................... GAGGTTCGTGGGGGTAATCCCGGCTTGCGA 398 36 100.0 30 .................................... AGAGGCAACGAGACTACAGACGCACTTAGA 464 36 100.0 30 .................................... TTTGGTCGAATTCTTCCGCATCTTTAAACT 530 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== =============================== ================== 9 36 100.0 31 GTTTTAGAGCTATGTTATTTTGAATGCTACCAAAAC # Left flank : | # Right flank : | # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTATGTTATTTTGAATGCTACCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:69.44%AT] # Reference repeat match prediction: F [matched GTTTTAGAGCTATGTTATTTTGAATGCTACCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-1.30,-0.80] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [0.0-0.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.87,0 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 697-1 **** Predicted by CRISPRDetect 2.4 *** >NZ_QDBI01000016.1 Listeria monocytogenes strain ICDC_LM1233 LM1233Scaffold15_1, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 696 36 100.0 30 .................................... ACTTACTGAACAACATTGATTACCACAGTT 630 36 100.0 30 .................................... TAATAAACAAGAAATATTACTTCATGAATC 564 36 100.0 30 .................................... CACTATCCACTACAGTGATTTGTATTGTGC 498 36 100.0 30 .................................... AACCTGCAGGTGCTGTGTTCACGTCAGCAA 432 36 100.0 30 .................................... TGTTGTCAAAGATGGTAATAAATGGGTGAC 366 36 100.0 30 .................................... CATCGAATTGATACTTTTCGAGTGAAGCAA 300 36 100.0 30 .................................... GTGGGAAACGTTAAATATTATAAAACAGAT 234 36 100.0 30 .................................... GCATCGTACCCCAGTTCATGAAGCGCGGTA 168 36 100.0 30 .................................... ACAAAACTCTCTAATTCAATTGCTCCATCA 102 36 100.0 30 .................................... TTTATAAAGAATACTTGCGGGGCATAAATG 36 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 11 36 100.0 30 GTTTTAGAGCTATGTTATTTTGAATGCTACCAAAAC # Left flank : | # Right flank : C # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTATGTTATTTTGAATGCTACCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:69.44%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTATGTTATTTTGAATGCTACCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.80,-1.30] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [0.0-0.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.87 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], //