Array 1 320-20 **** Predicted by CRISPRDetect 2.4 *** >NZ_MAWU01000022.1 Streptococcus agalactiae strain CZ-PW-150 NODE_2_length_277310_cov_124.946_ID_3, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 319 36 100.0 30 .................................... ACGATGTTTGTGAAAGACAAAATCTTCGCT 253 36 100.0 30 .................................... GTTGATCTTATTCACGTTTCGTGAAGTTTA 187 36 100.0 30 .................................... CAGAAAAAATCATGGCGAGAGCCTTGCTCA 121 36 100.0 30 .................................... ATCCATTCCTACAGGAATCACTCAAAATAT 55 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 5 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : CGAAAAGCCAGAAGTGAAATCAATGGTAGAAAAATTAGCAGCTACTATTACAGAACTTATCGCATTTGAGTGTCTAGAGAATGAGCTTGATTTAGAATACGATGAAATTACGATTTTAGAACTCATTAAGGCACTGGGAGTCAAAATTGAGACACAGAGCGACACTATCTTTGAAAAATGTTTTGAAATTATACAAGTTTACCATTATTTAACGAAAAAGAATCTCTTGGTTTTTGTTAATAGCGGAGCTTATCTTACCAAAGATGAAGTTATAAAATTATGTGAATACATCAATTTAATGCAAAAGTCAGTACTCTTTCTAGAACCTAGAAGACTCTATGATTTACCGCAATATGTTATTGATAAGGATTATTTCTTGATAGGCGAAAATATGGTATAATATTAGTAAAAGCACAGTAATAACAAGGAATCATCGAAACTGAAGTCCTGCTGAGACGAATGGCGCGATTACGAAAGCTCAAAAGAAAATTTTCTACGAG # Right flank : CAGCGGATGTCAATAGATTT # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [20.0-56.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,5.14 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 20-913 **** Predicted by CRISPRDetect 2.4 *** >NZ_MAWU01000021.1 Streptococcus agalactiae strain CZ-PW-150 NODE_29_length_932_cov_301.413_ID_57, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 20 36 100.0 30 .................................... ACGATGTTTGTGAAAGACAAAATCTTCGCT 86 36 100.0 30 .................................... GTTGATCTTATTCACGTTTCGTGAAGTTTA 152 36 100.0 30 .................................... CAGAAAAAATCATGGCGAGAGCCTTGCTCA 218 36 100.0 30 .................................... ATTAATATTGGTCAGAATAAGCTATTTCAG 284 36 100.0 30 .................................... GATATTTGGAAAGATTCTGATTTTGGTAAG 350 36 100.0 30 .................................... TTACCGAAAGAGTGGAAAAACTACTCAGTG 416 36 100.0 30 .................................... ATCCATTCCTACAGGAATCACTCAAAATAT 482 36 100.0 30 .................................... AGCGGATGTCAATAGATTTCTACGAACAAG 548 36 100.0 30 .................................... CAAGAATTATAGTAGGTTATTAAAGTTAAT 614 36 100.0 30 .................................... TGGCGAAAAATGGTATTATCTCAAAGGCAA 680 36 100.0 30 .................................... TTTTTACCAATGCTTCCATATCGCTTATAT 746 36 100.0 30 .................................... TACTTGACGAATTGAAGATGACGGAATTTA 812 36 100.0 30 .................................... TGGTTATACATTTACTAATCCATCAGCATT 878 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 14 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : AAAGAAAATTTTCTACGAGG # Right flank : AAGCTAATTCTCATCTTAA # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-4.70,-0.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [23.3-23.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.87,0 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 384-18 **** Predicted by CRISPRDetect 2.4 *** >NZ_MAWU01000039.1 Streptococcus agalactiae strain CZ-PW-150 NODE_45_length_400_cov_392.064_ID_89, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 383 36 100.0 30 .................................... ATTAATATTGGTCAGAATAAGCTATTTCAG 317 36 100.0 30 .................................... GATATTTGGAAAGATTCTGATTTTGGTAAG 251 36 100.0 30 .................................... TTACCGAAAGAGTGGAAAAACTACTCAGTG 185 36 100.0 30 .................................... AGCGGATGTCAATAGATTTCTACGAACAAG 119 36 100.0 30 .................................... CAAGAATTATAGTAGGTTATTAAAGTTAAT 53 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 6 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : CGTCAAAGCCTTGCTC # Right flank : CTGGCGAAAAATGGTATT # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [18.3-13.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.87 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 1-234 **** Predicted by CRISPRDetect 2.4 *** >NZ_MAWU01000048.1 Streptococcus agalactiae strain CZ-PW-150 NODE_53_length_252_cov_388.797_ID_105, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 1 36 100.0 30 .................................... TTACCGAAAGAGTGGAAAAACTACTCAGTG 67 36 100.0 30 .................................... AGCGGATGTCAATAGATTTCTACGAACAAG 133 36 100.0 30 .................................... TGGTTATACATTTACTAATCCATCAGCATT 199 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 4 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : | # Right flank : AAGCTAATTCTCATGGGA # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-4.70,-0.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [0.0-18.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.87,0.27 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 20-319 **** Predicted by CRISPRDetect 2.4 *** >NZ_MAWU01000043.1 Streptococcus agalactiae strain CZ-PW-150 NODE_49_length_337_cov_226.343_ID_97, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 20 36 100.0 30 .................................... TGGCGAAAAATGGTATTATCTCAAAGGCAA 86 36 100.0 30 .................................... TTTTTACCAATGCTTCCATATCGCTTATAT 152 36 100.0 30 .................................... TACTTGACGAATTGAAGATGACGGAATTTA 218 36 100.0 30 .................................... TGGTTATACATTTACTAATCCATCAGCATT 284 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 5 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : CAGGAATCACTCAAAATATG # Right flank : AAGCTAATTCTCATCTTG # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:59.46%AT] # Reference repeat match prediction: F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-4.70,-0.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [21.7-18.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.28,0 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 20-187 **** Predicted by CRISPRDetect 2.4 *** >NZ_MAWU01000051.1 Streptococcus agalactiae strain CZ-PW-150 NODE_56_length_202_cov_480.55_ID_111, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 20 36 100.0 30 .................................... AGCGGATGTCAATAGATTTCTACGAACAAG 86 36 100.0 30 .................................... CAAGAATTATAGTAGGTTATTAAAGTTAAT 152 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 3 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : AGATTCTGATTTTGGTAAGG # Right flank : TGGCGAAAAATTAGT # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.97%AT] # Reference repeat match prediction: F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-4.70,-0.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [18.3-16.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.28,0 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 43882-43714 **** Predicted by CRISPRDetect 2.4 *** >NZ_MAWU01000009.1 Streptococcus agalactiae strain CZ-PW-150 NODE_18_length_43900_cov_117.972_ID_35, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 43881 36 100.0 30 .................................... CAAGAATTATAGTAGGTTATTAAAGTTAAT 43815 36 100.0 30 .................................... TACTTGACGAATTGAAGATGACGGAATTTA 43749 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 3 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : CCCTATTTCTACGAACAA # Right flank : AAGCTAATTCTCATCTCACCGAGATGGATAGTTTTAGAGCTGTGCTGTTATTATGCTAGGACATCATTGTGGTGTTCTAGTTTTTTGTTATACTGAAATAAATTTTCAGAGAATGTGGGGGAAGGCGGTAATTAGATTAATTCAAGACGTAATTCAGAACTTAGTTGGCCAAGCTAACGAAATCACCCCAATTTATCAGTTTGATTGGGAAACTTATATATTGGCGACTAAAAAATATGAACGTCATTTAGAGGTGTGTCTATTAGTAGAAAATTCGAATTGTTTTTCGGATTCAAAGAGAATGTGTCAATAAAAGAGATATGAAAGGCTATAATTCCAACCTTATGGTTAAAGGGCTAGGTTGTTCTACGCTTTACTTAATTATTAGTTTGACAGCGTTGGTTCTTTTAGTGATTGCTGGTGTTTTCTTTGTCATTAATACTTGCAAGCTTACAAGGAAAGCAGTGGAGAACCTATCCATAATCAACTAACAGCTATGA # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [60.0-18.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.27,4.87 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], //