Array 1 40-1029 **** Predicted by CRISPRDetect 2.4 *** >NZ_JAEMEY010000158.1 Vibrio cholerae strain Vc226 NODE_158_length_1029_cov_1.610294, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================= ================== 40 28 100.0 32 ............................ TGTAAAGGACGAGGCCAACCACGCAAGCAGCA 100 28 100.0 32 ............................ ACAGACGGCCGGAACGGAAACATCCCCTGTGA 160 28 100.0 32 ............................ CGACAAGGCAACTTACAGTTCACAGAGAGGAC 220 28 100.0 32 ............................ TTTCTTTTTGAGAGCAAAGCCACACTTTAAGT 280 28 100.0 32 ............................ CGCCCCAGAAAATCATCTGGCAGGGAGAAAGC 340 28 100.0 32 ............................ TTTTGAAATCAGAGCAGAATTATAAAGGTTAG 400 28 100.0 32 ............................ TTTCGCCGTAAGTGGCTGAACTATAGAGGGTT 460 28 100.0 32 ............................ TTAAGCACGCTTCTATTTCAGAATTGCAACGT 520 28 100.0 32 ............................ TGAATTTGAAAAGGCAATCCGTGATTACGTCA 580 28 100.0 32 ............................ ATACGCCCGTCGCGTTACCTTTTGACACTCCT 640 28 100.0 32 ............................ TCAATTCTCTATGTGTGCATTATGCGTGCACT 700 28 100.0 33 ............................ ATGAAATATATTCCTTATTGCTTTAACGGATTT 761 28 100.0 32 ............................ GTGCAGGAATTATAGGTATGAGCTATGGCGTA 821 28 100.0 33 ............................ CGCAAAATGCAGCAATACCTTGCTCGTGGTTCT 882 28 100.0 33 ............................ CTTTGGCGGCAGGTCCATTTGCTGCCCCGTTCT 943 28 100.0 32 ............................ TCGTCCATGCCGTCGTCAATGTCGGCCTGTAT 1003 27 92.9 0 ..............C............- | ========== ====== ====== ====== ============================ ================================= ================== 17 28 99.6 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : TTAGAAAACTTAATGCGCATTAGGGCCATTATGTTACGGG # Right flank : | # Questionable array : NO Score: 6.24 # Score Detail : 1:0, 2:3, 3:0, 4:0.98, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [8,5] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.00,-7.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-2] Score: 0.41/0.41 # AT richness analysis in flanks prediction: F [40.0-0.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.92,0 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 210-1 **** Predicted by CRISPRDetect 2.4 *** >NZ_JAEMEY010000981.1 Vibrio cholerae strain Vc226 NODE_994_length_249_cov_1.697674, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================= ================== 209 28 96.4 33 .A.......................... ATCGAAGAGCTTACTCAGCAAGGCAGCTATATT 148 28 100.0 32 ............................ TTTTGCAACCGCTCTAGATCACCAATTGAACT 88 28 100.0 32 ............................ GCACAAATAAAAGGCAATACCTCATATTCGGC 28 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================= ================== 4 28 99.1 33 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : CTTAGAAATCAATTCTCTATGTGTGCATTATGCGTGCAT # Right flank : A # Questionable array : NO Score: 5.81 # Score Detail : 1:0, 2:3, 3:0, 4:0.95, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [5,8] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.70,-8.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [0.0-43.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.41,5.51 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 361-33 **** Predicted by CRISPRDetect 2.4 *** >NZ_JAEMEY010000497.1 Vibrio cholerae strain Vc226 NODE_498_length_381_cov_1.878289, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 360 28 100.0 32 ............................ ATCACCCTGCGCACCGAGCTGAAAAACAGCTT 300 28 100.0 32 ............................ AACAGGTGACAGGGTAGCACCACAGCAGTTAT 240 28 100.0 32 ............................ GAGCAGCAAGTAAAAGCTTTGCGAATCGTAGA 180 28 100.0 32 ............................ TTGCTTAAAGCGTTGAGGAAGTCTCAACCGTT 120 28 100.0 32 ............................ CGTTCTGGCGGCCTGAACGCGCCAACGCGCCA 60 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 6 28 100.0 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : TGAAAGCGGAATGGCTACGC # Right flank : ATAATTTATCAGCCTCATAAAACTCACCAAATC # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [5,8] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.70,-8.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [36.7-16.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.27,5.24 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 676-348 **** Predicted by CRISPRDetect 2.4 *** >NZ_JAEMEY010000257.1 Vibrio cholerae strain Vc226 NODE_257_length_683_cov_2.016502, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 675 28 85.7 32 ..C.G......C.......C........ TTGGGGGGAGGCGAAGCCGCCACAAAATACAC 615 28 100.0 32 ............................ TTTTAAGCACCACTGGCAATAAGCCGTCATTT 555 28 100.0 32 ............................ TGATGAATGGCCCGATTGCCGATATCGAGTGC 495 28 100.0 32 ............................ ACAAGAGCAGAGAGTGAAAACTAATCTAGGTT 435 28 96.4 32 ...........C................ CATAAATTCAAGTTGCCGCGCTTTGTCTGGTA 375 28 89.3 0 ...........C.............TT. | ========== ====== ====== ====== ============================ ================================ ================== 6 28 95.2 32 GTTCACTGCCGTACAGGCAGCTTAGAAA # Left flank : CTGAGGA # Right flank : AGAAAGTAAATCAAACGAGGCAGTTCACTTTCTAGATTACGTTAAGGTTCTTACGTTCTGCTACGTATATTTATTAGGGTTTTCTTAAATGGTCTTTTCCCAAGCATTAGTGACAAATTTCCGAGGTGTAATGATTAAGATAGCCCAGTTGATGAGTATCAGTTGAGGGGTAGTCACCATGAGCATCGTTGGTTGTGTTAATATCAAATCCAAGTATATCGATCGAACATGTCAGATGGTCTCGTAAGCCAAGTTTTACTCAGGGCGAGTTTTGCGTCAATAAAAATCCTTTTAGAATCATAACGTAATGAGCTATTGGATTACATCAGCTTCCATGTCTTAAGTGGA # Questionable array : NO Score: 6.02 # Score Detail : 1:0, 2:3, 3:0, 4:0.76, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGTACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [6,8] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTTCACTGCCGTACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.70,-8.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [4-4] Score: 0/0.41 # AT richness analysis in flanks prediction: F [61.7-5.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.27,5.24 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 22-349 **** Predicted by CRISPRDetect 2.4 *** >NZ_JAEMEY010000540.1 Vibrio cholerae strain Vc226 NODE_541_length_358_cov_1.747331, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 22 28 100.0 32 ............................ GCTACGGCGTTACGTATCGTATCTAAGGAATT 82 28 100.0 32 ............................ ACTGGGGTGAGGCGGCTAATCAGGCGTTAGAT 142 28 100.0 32 ............................ ACATAAAGCCCGATGTGTGAAAGTGGCGGCTT 202 28 100.0 32 ............................ TTTCAAGCGGTTGCTGAATTGTGGATGGACAC 262 28 100.0 32 ............................ ACCAGTTCTGGCCATGTAGAGGTGAGTGAAGT 322 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 6 28 100.0 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : CATGCCTCCAGCCATTGATATG # Right flank : TTTTCTGAA # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [8,6] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-8.60,-9.10] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [16.7-11.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.28,0.37 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 24-348 **** Predicted by CRISPRDetect 2.4 *** >NZ_JAEMEY010000566.1 Vibrio cholerae strain Vc226 NODE_567_length_348_cov_1.881919, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 24 28 100.0 32 ............................ GTCAATGTGGTGTGGCGTTAGCGGAAGTTATC 84 28 100.0 32 ............................ GTCCCCACCAGTAGATAAAGCAGGAGCATTTT 144 28 100.0 32 ............................ TATCTCACCCGTTATAAGATTAATAGCCAAAC 204 28 100.0 32 ............................ TGTCGATTTACATGAGTGCGTACTTTGGTTAC 264 28 100.0 32 ............................ GTCGTACACCATTTCGGCACACATCAGCTCTT 324 25 89.3 0 .........................--- | ========== ====== ====== ====== ============================ ================================ ================== 6 28 98.2 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : GTGTGGCGTTAGCGGAAGTTATCG # Right flank : | # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [8,5] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-8.60,-9.10] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [18.3-43.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.87,0.64 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 42-249 **** Predicted by CRISPRDetect 2.4 *** >NZ_JAEMEY010000684.1 Vibrio cholerae strain Vc226 NODE_685_length_303_cov_1.318584, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 42 28 100.0 32 ............................ TTACTGAACCAGACTGGCGATTTTGGCCAGAG 102 28 100.0 32 ............................ ATCAAAAAGGCTCTTTGTCGAGTCTTTCATAT 162 28 100.0 32 ............................ GCCTTTACTACCTGACCAGGTGTTGAACTCAA 222 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 4 28 100.0 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : GCTTAGAAATATTCAGTTTTGCAAGGTACTGATTTATCCAAG # Right flank : TTTTTACGACATTGTGCAGGTGTGTCGAGTTCGTTCACTGCCGCACAGGCAGCT # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [8,5] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.00,-7.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [46.7-43.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.24,0 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 322-54 **** Predicted by CRISPRDetect 2.4 *** >NZ_JAEMEY010000618.1 Vibrio cholerae strain Vc226 NODE_619_length_326_cov_2.052209, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 321 28 100.0 32 ............................ AGTTTGAAACCACTGATCCCGTTGAAGGTGGC 261 28 100.0 32 ............................ ATCTGCAGATTGGGCTCAGGCTGGTCCTCTTG 201 28 100.0 32 ............................ GCCAGTGAAACTTAATGCCACGCCGAGAAACC 141 28 100.0 32 ............................ TGTAGTATCGGTAATTGCCCATGCCTGATTCC 81 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 5 28 100.0 32 GTTCACTGCCGCACAGGCAGCTTAGAAA # Left flank : AATT # Right flank : AGTTAAAAGAAGTGTACCTTTTAAAAGGTACTAGTTCACTGCCGCACAGGCAGC # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGCACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [5,8] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTTCACTGCCGCACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-9.10,-8.60] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [50.0-6.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.64,4.87 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], //