Array 1 360-26 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_JABDRY010000417.1 Stenotrophomonas maltophilia strain Tong2 NODE_418_length_362_cov_0.289362, whole genome shotgun sequence		Array_Orientation: Reverse

  Position	Repeat	   %id	Spacer	Repeat_Sequence              	Spacer_Sequence                 	Insertion/Deletion
==========	======	======	======	=============================	================================	==================
       359	    29	 100.0	    32	.............................	GCCGGGTTAAGAAGGTGTATGGATGGCCCGGA	
       298	    29	 100.0	    32	.............................	GGTTACGCCTGCACAGAGTACAATGCGTGGGG	
       237	    29	 100.0	    32	.............................	CGGTGATGCGCGGTATCGATCAGCATCCGGCT	
       176	    29	 100.0	    32	.............................	GCTCATTTCAAATGGTCAGGTCCGGTGGTTTT	
       115	    29	  96.6	    32	............................C	TGATCACATCATGTTTATTCGCGGTCGTATTG	
        54	    29	 100.0	     0	.............................	|                               	
==========	======	======	======	=============================	================================	==================
         6	    29	  99.4	    32	GAGTTCCCCGCGCCAGCGGGGATAAACCG	                                	       

# Left flank :   AG
# Right flank :  GTACTGGAAAAAGCTGGCGACGGTGA

# Questionable array : NO	 Score: 6.23
# 	Score Detail : 1:0, 2:3, 3:0, 4:0.97, 5:0, 6:0.25, 7:0.01, 8:1, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GAGTTCCCCGCGCCAGCGGGGATAAACCG
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     R [3,6] Score: 0.37/0.37
# 	Reference repeat match prediction:         R [matched GAGTTCCCCGCGCCAGCGGGGATAAACCG with 100% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  R [-12.00,-13.50] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      R [1-0] Score: 0.41/0.41
# 	AT richness analysis in flanks prediction: F [20.0-3.3]%AT Score: 0.27/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         R [0.27,5.65   Confidence: HIGH] 

# Array family : I-E [Matched known repeat from this family],   
//


Array 1 7-260 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_JABDRY010001051.1 Stenotrophomonas maltophilia strain Tong2 NODE_1054_length_279_cov_0.276316, whole genome shotgun sequence		Array_Orientation: Forward

  Position	Repeat	   %id	Spacer	Repeat_Sequence              	Spacer_Sequence                                                           	Insertion/Deletion
==========	======	======	======	=============================	==========================================================================	==================
         7	    29	 100.0	    32	.............................	GTCATCACGATGAATCAAAATTTCGCCCGGCT                                          	
        68	    29	 100.0	    32	.............................	ATTGTTATAATTATTTATTGAAATATCATTCC                                          	
       129	    29	 100.0	    74	.............................	AATAAGGCGCGGCGCCACCCTCGGCTTTAATTGTGTTCCCCGCGCCGACGCGTTCCAGCGCACGTTACTCGATC	
       232	    29	 100.0	     0	.............................	|                                                                         	
==========	======	======	======	=============================	==========================================================================	==================
         4	    29	 100.0	    46	GTGTTCCCCGCGCCAGCGGGGATAAACCG	                                                                          	       

# Left flank :   TTCAGGG
# Right flank :  AGCCGTTTCCGCTAAATAC

# Questionable array : NO	 Score: 4.56
# 	Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:-1.29, 8:0.6, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTGTTCCCCGCGCCAGCGGGGATAAACCG
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     F [5,4] Score: 0.37/0.37
# 	Reference repeat match prediction:         F [matched GTGTTCCCCGCGCCAGCGGGGATAAACCG with 100% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  F [-13.50,-12.00] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      NA [0-0] Score: 0/0.41
# 	AT richness analysis in flanks prediction: R [5.0-16.7]%AT Score: 0.27/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         F [5.24,0.27   Confidence: HIGH] 

# Array family : I-E [Matched known repeat from this family],   
//