Array 1 1-268 **** Predicted by CRISPRDetect 2.4 *** >NZ_LXHB01000148.1 Moraxella catarrhalis strain Z7546 Z7546_ctg-9000015, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 1 28 100.0 32 ............................ AATCAAACTGATCTCGCTGCTGAAACTCAAGC 61 28 100.0 32 ............................ TGTCAGTAAATCTTTTGGTAATGTATGGTGTT 121 28 100.0 32 ............................ TAGCAATTTAAGATAAAATCGTTTATTATTAC 181 28 100.0 32 ............................ CAGATAACTTCCCCATCATCATTGCCAAATTG 241 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 5 28 100.0 34 CTTCACGACCGCATAGGTCGCTTAGAAA # Left flank : | # Right flank : A # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : CTTCACGACCGCATAGGTCGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [8,6] Score: 0.37/0.37 # Reference repeat match prediction: F [matched CTTCACGACCGCACAGGTCGCTTAGAAA with 97% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-7.40,-7.10] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [0.0-1.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.24,0 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 14187-13859 **** Predicted by CRISPRDetect 2.4 *** >NZ_LXHB01000002.1 Moraxella catarrhalis strain Z7546 Z7546_ctg-1000008, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 14186 28 100.0 32 ............................ CATGAGATTACAGGCCAAGACTTAACACAATG 14126 28 100.0 32 ............................ ATCAAATCCATGCTTAGTTTCACCGTTTAAAT 14066 28 100.0 32 ............................ ATGTCTTTTTGTGTTAGCCATGTAATTTGTTT 14006 28 100.0 32 ............................ TGATGGGTGCGAGTGTGTGCTGTGAGTGCAAC 13946 28 100.0 32 ............................ ACAAAAAATCAAAGAGCGTGATGAAAACACTA 13886 28 96.4 0 .............T.............. | ========== ====== ====== ====== ============================ ================================ ================== 6 28 99.4 32 CTTCACGACCGCACAGGTCGCTTAGAAA # Left flank : | # Right flank : ATTTAATGGACAAACCAAAACTAATTCAACAATAGATCAGAACATGACCGAAAACAGGACAGAAAAAGGTATTGGTAGAAATATTATGCTAGTATCTTCTGGGAGTTCTGAGATGTCAGGCGCAGTAGAAGTTGGAAAGAGTCAAGAAATTAACACTAATACAGGTTGGACTACCAGTATATCTTTAGATCATGTTGGCAAATTAGATCATGCCATTATGAAATTTAGAATGAAGCAGCCCGAGGAGTATGACAAAGCATATCAAGAAGCAGCTAAAAATTTAGGTATAGACCCGCAACAAGATTATTTGCAATTAGAAAGTACGGATAGGCTGAATATGCGAGATACTTTAAATCCAATCGCTATGCAGAAAAACCAAACATATCTCGGACAATCCAAACCTACAAATGGACTGCCGCAGAACATCGGTGATGTGGCGGCAAAACATTTAAAAAATAATAATGAAATAAAGATGCACTATCAAGACGCTATACAGGATT # Questionable array : NO Score: 6.23 # Score Detail : 1:0, 2:3, 3:0, 4:0.97, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : CTTCACGACCGCACAGGTCGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [5,8] Score: 0.37/0.37 # Reference repeat match prediction: R [matched CTTCACGACCGCACAGGTCGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.10,-7.40] Score: 0.37/0.37 # Array degeneracy analysis prediction: R [1-0] Score: 0.41/0.41 # AT richness analysis in flanks prediction: F [66.7-0.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.27,5.65 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 271-3 **** Predicted by CRISPRDetect 2.4 *** >NZ_LXHB01000024.1 Moraxella catarrhalis strain Z7546 Z7546_ctg-13000007, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 270 28 100.0 32 ............................ TGCGACATCATCCAAAATTCAAGACACCCTAC 210 28 100.0 32 ............................ CAATGAATCTAAATCAGTTGCCATTACAACTC 150 28 100.0 32 ............................ TAACGCTTTCCAATGAAAACCCATCACTTGAC 90 28 100.0 32 ............................ TTTAAGTTTTCTTTGGGTGAATAATAAAGTGT 30 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 5 28 100.0 32 CTTCACGACCGCATAGGTCGCTTAGAAA # Left flank : | # Right flank : ATG # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : CTTCACGACCGCATAGGTCGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:51.72%AT] # Reference repeat match prediction: R [matched CTTCACGACCGCACAGGTCGCTTAGAAA with 97% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.10,-7.40] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [0.0-1.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.41,4.87 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 1-207 **** Predicted by CRISPRDetect 2.4 *** >NZ_LXHB01000143.1 Moraxella catarrhalis strain Z7546 Z7546_ctg-10000009, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 1 28 100.0 31 ............................ AAAAAGATGGTAGAATCAGTTATTGGCTTGA 60 28 100.0 32 ............................ ACTGACACTGACTTGCATACCTTTTTTAGCTA 120 28 100.0 32 ............................ GCTCGCCAGTCAGCCACTAGAGATTTTACGCA 180 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 4 28 100.0 32 CTTCACGACCGCACAGGTCGCTTAGAAA # Left flank : | # Right flank : GTC # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : CTTCACGACCGCACAGGTCGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [8,5] Score: 0.37/0.37 # Reference repeat match prediction: F [matched CTTCACGACCGCACAGGTCGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-7.40,-7.10] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [0.0-1.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.24,0 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 572-3 **** Predicted by CRISPRDetect 2.4 *** >NZ_LXHB01000029.1 Moraxella catarrhalis strain Z7546 Z7546_ctg-1000001, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================= ================== 571 28 100.0 32 ............................ ACAGCCTGAACCGCCAAGAATGGAAAGTTTGA 511 28 100.0 32 ............................ AAATTGCCCATTTTTTTGCTCTCAAAAAATAA 451 28 100.0 32 ............................ AGGAAGTTTCAACAGTACTCAAGGCAACATGA 391 28 100.0 32 ............................ AAGCGATTGATGCGCTATAGCTATTGCCCTCG 331 28 100.0 32 ............................ AACCCAACGCCAAAAAGTGATTGGATTGGGTG 271 28 100.0 32 ............................ TAAAGACATCTCAATCCAATTACTTAGACATA 211 28 100.0 32 ............................ GAGCGGGGCGGGTGCGTGAAAGCTGAAACCAA 151 28 100.0 33 ............................ CGATTTATGCGATCACAAATCAAGAAAGTTTTA 90 28 100.0 32 ............................ ACACGGGAAAATTCCTGTCTCTCGATCAATCT 30 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================= ================== 10 28 100.0 32 CTTCACGACCGCATAGGTCGCTTAGAAA # Left flank : TCGCATTGCGGCTTGGGTGATGGATGTCCCTGTGCCAAGTAAGATGACTGTGGTATTGGCGATGGGGATATTATAATAGTGGTTTTGGTATTTCGTTTCGGTGAGATACAGGATGCGCCCGTCTTTTTGCATGACTCGGCAATGCTCAAGATAAAATACATTGGCGCGCTTGGAGTGCAAAATTGCCTTAAGATCCGTGGGTTTGAGCGTATCCATGACGTCAATTTCCTTAATGATGAATTTAATTTAATCACACCCATTATAGCCTGTCAAGCGATGATGCGACCAAATTATAAGCTTATATTATCCATCTGCCATATCAGTTATGCTATACTAAATTTGCCATCAGATGATGATGGGTGTAAAAAACCTTTATTTTTTCACTATTTAAAAACTTGAATATTTTCAATAAGTTATAACTAGTCAACTTTTGATTGGATAAAAAGGGTCAATCCATCATAAATGGCTGTTATTTCTTAATTTTTTCGGTTATAATTACT # Right flank : ATG # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : CTTCACGACCGCATAGGTCGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [6,8] Score: 0.37/0.37 # Reference repeat match prediction: R [matched CTTCACGACCGCACAGGTCGCTTAGAAA with 97% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.10,-7.40] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [1.7-73.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,5.51 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], //