Array 1 209-1 **** Predicted by CRISPRDetect 2.4 *** >NZ_LIMW01000058.1 Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N45393 N45393_contig_58, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================= ================================ ================== 208 28 96.6 32 -............................ AGCCGTTTCCGCTAAATACCCCCGCAGTGATT 148 29 100.0 32 ............................. TTCTTGAATATGATTGCGGGTATATGTGGATA 87 29 100.0 32 ............................. TCTGGTTATAACATCGCAGCAAAATCAAAAGA 26 26 89.7 0 ..........................--- | ========== ====== ====== ====== ============================= ================================ ================== 4 29 96.6 32 GTGTTCCCCGCGCCAGCGGGGATAAACCG # Left flank : | # Right flank : A # Questionable array : NO Score: 5.69 # Score Detail : 1:0, 2:3, 3:0, 4:0.83, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTGTTCCCCGCGCCAGCGGGGATAAACCG # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [4,5] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTGTTCCCCGCGCCAGCGGGGATAAACCG with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-8.90,-10.50] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [0.0-0.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,5.24 Confidence: HIGH] # Array family : I-E [Matched known repeat from this family], // Array 1 1-330 **** Predicted by CRISPRDetect 2.4 *** >NZ_LIMW01000081.1 Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N45393 N45393_contig_81, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================= ================================ ================== 1 28 96.6 32 -............................ CCGCTGACGCACTGGATCAACCTGACGCAACG 61 29 100.0 32 ............................. TTGCAGGGCGATATTGTTGTTGGTGAATGGGA 122 29 100.0 32 ............................. CGTCGCGGAAAATTTCGCATTGACGATAAAGA 183 29 100.0 32 ............................. TTACGTGTTTATTCATCTGTTGCATTAGATTC 244 29 96.6 32 ............................T GAGGCGTACAGGCTGTTAGATGAGAAATTACC 305 26 89.7 0 ..........................--- | ========== ====== ====== ====== ============================= ================================ ================== 6 29 97.2 32 GTGTTCCCCGCGCCAGCGGGGATAAACCG # Left flank : | # Right flank : | # Questionable array : NO Score: 6.12 # Score Detail : 1:0, 2:3, 3:0, 4:0.86, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTGTTCCCCGCGCCAGCGGGGATAAACCG # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [5,4] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTGTTCCCCGCGCCAGCGGGGATAAACCG with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-10.50,-8.90] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-2] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [0.0-0.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.65,0 Confidence: HIGH] # Array family : I-E [Matched known repeat from this family], //