Array 1 672-42 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBKY01000021.1 Streptococcus agalactiae strain NOVUI-11 NODE_29_length_712_cov_66.3906_ID_57, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 671 36 100.0 30 .................................... ATCAACTGCTAGATACGATAACACGACAAC 605 36 100.0 30 .................................... TACCACCTGATGGATTATCAAGTGATAAAT 539 36 100.0 30 .................................... TAACTTTAATTCGATTATGTTTTGGTTATC 473 36 100.0 30 .................................... GTAAGTATTTTAAACGTGACTATTCCTGAA 407 36 100.0 30 .................................... TTTTTATTATGGAAAGTAATCATTATTTTT 341 36 100.0 30 .................................... GATATTTGGAAAGATTCTGATTTTGGTAAG 275 36 100.0 30 .................................... TTACCGAAAGAGTGGAAAAACTACTCAGTG 209 36 100.0 30 .................................... ATCCATTCCTACAGGAATCACTCAAAATAT 143 36 100.0 30 .................................... AGCGGATGTCAATAGATTTCTACGAACAAG 77 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 10 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : GGTTCCAAAACCATGCTTGCTGTTGTAAATTGCCCGACTG # Right flank : CCATGCTTGCTGTTGTAAATTGCCCGACTGTGTTTTAGAGCT # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [38.3-36.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.87 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 42-275 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBKY01000034.1 Streptococcus agalactiae strain NOVUI-11 NODE_40_length_315_cov_61.584_ID_79, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 42 36 100.0 30 .................................... TTCTTTAATACCTGAAATCATTGCGTTGTA 108 36 100.0 30 .................................... AGGGAGGAGAGAATCAATGCCGAATGCTGA 174 36 100.0 30 .................................... TGGCGAAAAATGGTATTATCTCAAAGGCAA 240 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 4 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : GGTTCCAAAACCATGCTTGCTGTTGTAAATTGCCCGACTGTG # Right flank : TTTTTACCAATGCTTCCATATCGCTTATATGTTTTAGAGC # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-4.70,-0.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [36.7-45.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.87,0 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 2-235 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBKY01000038.1 Streptococcus agalactiae strain NOVUI-11 NODE_44_length_276_cov_70.0101_ID_87, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 2 36 100.0 30 .................................... TTTTTACCAATGCTTCCATATCGCTTATAT 68 36 100.0 30 .................................... TACTTGACGAATTGAAGATGACGGAATTTA 134 36 100.0 30 .................................... TGGTTATACATTTACTAATCCATCAGCATT 200 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 4 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : AG # Right flank : AAGCTAATTCTCATCTCACCGAGATGGATAGTTTTAGAGCT # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:59.46%AT] # Reference repeat match prediction: F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-4.70,-0.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [1.7-40.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.28,0.27 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 2-169 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBKY01000039.1 Streptococcus agalactiae strain NOVUI-11 NODE_45_length_210_cov_49.3609_ID_89, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 2 36 100.0 30 .................................... TTTTTACCAATGCTTCCATATCGCTTATAT 68 36 100.0 30 .................................... TACTTGACGAATTGAAGATGACGGAATTTA 134 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 3 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : AG # Right flank : AAGCTAATTCTCATCTCACCGAGATGGATAGTTTTAGAGCT # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:59.46%AT] # Reference repeat match prediction: F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-4.70,-0.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [1.7-40.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.28,0.27 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 170-2 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBKY01000040.1 Streptococcus agalactiae strain NOVUI-11 NODE_46_length_210_cov_58.8722_ID_91, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 169 36 100.0 30 .................................... TTCTTTAATACCTGAAATCATTGCGTTGTA 103 36 100.0 30 .................................... AGGGAGGAGAGAATCAATGCCGAATGCTGA 37 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 3 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : GGTTCCAAAACCATGCTTGCTGTTGTAAATTGCCCGACTG # Right flank : CT # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:59.46%AT] # Reference repeat match prediction: R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-0.20,-4.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [1.7-35.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.41,5.14 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 42-407 **** Predicted by CRISPRDetect 2.4 *** >NZ_MBKY01000010.1 Streptococcus agalactiae strain NOVUI-11 NODE_19_length_44140_cov_64.2825_ID_37, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 42 36 100.0 30 .................................... TTCTTTAATACCTGAAATCATTGCGTTGTA 108 36 100.0 30 .................................... AGGGAGGAGAGAATCAATGCCGAATGCTGA 174 36 100.0 30 .................................... TTTTTACCAATGCTTCCATATCGCTTATAT 240 36 100.0 30 .................................... TACTTGACGAATTGAAGATGACGGAATTTA 306 36 100.0 30 .................................... TGGTTATACATTTACTAATCCATCAGCATT 372 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 6 36 100.0 30 GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Left flank : GGTTCCAAAACCATGCTTGCTGTTGTAAATTGCCCGACTGTG # Right flank : CAAGCTAATTCTCATCTCACCGAGATGGATAGTTTTAGAGCTGTGCTGTTATTATGCTAGGACATCATTGTGGTGTTCTAGTTTTTTGTTATACTGAAATAAATTTTCAGAGAATGTGGGGGAAGGCGGTAATTAGATTAATTCAAGACGTAATTCAGAACTTAGTTGGCCAAGCTAACGAAATCACCCCAATTTATCAGTTTGATTGGGAAACTTATATATTGGCGACTAAAAAATATGAACGTCATTTAGAGGTGTGTCTATTAGTAGAAAATTCGAATTGTTTTTCGGATTCAAAGAGAATGTGTCAATAAAAGAGATATGAAAGGCTATAATTCCAACCTTATGGTTAAAGGGCTAGGTTGTTCTACGCTTTACTTAATTATTAGTTTGACAGCGTTGGTTCTTTTAGTGATTGCTGGTGTTTTCTTTGTCATTAATACTTGCAAGCTTACAAGGAAAGCAGTGGAGAACCTATCCATAATCAACTAACAGCTATG # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC # Alternate repeat : GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAACA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:59.46%AT] # Reference repeat match prediction: F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-4.70,-0.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [1-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [36.7-60.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.28,0.27 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], //