Array 1 508-1 **** Predicted by CRISPRDetect 2.4 *** >NZ_QRWL01000051.1 Bacteroides uniformis strain AF19-23 AF19-23.Scaf51, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== =============================================== =============================== ================== 507 46 97.9 30 -.............................................. TCAGATGAATTATAAGATAAATCAGATGAA 431 47 100.0 30 ............................................... TACCTTGCGCTTGTAAAAGACGGCCAGCTG 354 47 100.0 30 ............................................... TTTCTTTATCTAAGTTTGAATAGGCTGTGT 277 47 100.0 29 ............................................... GAAGCCGAAATAAAATATGGGTTTCACCC 201 47 100.0 31 ............................................... AATTTCCCATGGTTGGATAGCATGCTTTGCA 123 47 100.0 30 ............................................... CACAAGCCGCAATAAAGGCAGCGCAAGACG 46 46 97.9 0 ..............................................- | ========== ====== ====== ====== =============================================== =============================== ================== 7 47 99.4 30 GTTGTGATTTGCTTTCATTTTAGTATCTTTGAACCATTGGAAACAGT # Left flank : | # Right flank : G # Questionable array : NO Score: 6.23 # Score Detail : 1:0, 2:3, 3:0, 4:0.97, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTGTGATTTGCTTTCATTTTAGTATCTTTGAACCATTGGAAACAGT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:68.09%AT] # Reference repeat match prediction: R [matched GTTGTGATTTGCTTTCAAATTAGTATCTTTGAACCATTGGAAACAGC with 96% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-1.00,-1.30] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [1-1] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [0.0-0.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.87 Confidence: HIGH] # Array family : II-C [Matched known repeat from this family], // Array 1 508-1 **** Predicted by CRISPRDetect 2.4 *** >NZ_QRWL01000052.1 Bacteroides uniformis strain AF19-23 AF19-23.Scaf52, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== =============================================== ============================== ================== 507 46 97.9 30 -.............................................. ACGCCAAAGTGTTTACGAATTTGTTCGCGA 431 47 100.0 30 ............................................... TTTGAGCAATAGACGTAAGAAGACTGACAG 354 47 100.0 30 ............................................... ACGCCAAAGTGTTTACGAATTTGTTCGAGA 277 47 100.0 30 ............................................... CTACAAATTCTTCCAACCCTACTTCCTTTG 200 47 100.0 30 ............................................... AGTTATCGCTCCGTTCATCCAGGACGCTAA 123 47 100.0 30 ............................................... GATAAATATTCCATATCCATGTGACAATTA 46 46 97.9 0 ..............................................- | ========== ====== ====== ====== =============================================== ============================== ================== 7 47 99.4 30 GTTGTGATTTGCTTTCATTTTAGTATCTTTGAACCATTGGAAACAGT # Left flank : | # Right flank : G # Questionable array : NO Score: 6.23 # Score Detail : 1:0, 2:3, 3:0, 4:0.97, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTGTGATTTGCTTTCATTTTAGTATCTTTGAACCATTGGAAACAGT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:68.09%AT] # Reference repeat match prediction: R [matched GTTGTGATTTGCTTTCAAATTAGTATCTTTGAACCATTGGAAACAGC with 96% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-1.00,-1.30] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [1-1] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [0.0-0.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.87 Confidence: HIGH] # Array family : II-C [Matched known repeat from this family], // Array 1 1-502 **** Predicted by CRISPRDetect 2.4 *** >NZ_QRWL01000053.1 Bacteroides uniformis strain AF19-23 AF19-23.Scaf53, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== =============================================== ============================== ================== 1 46 97.9 30 -.............................................. GGAAGTTTCTCTGTTGACTTTGAGAAATGT 77 47 100.0 29 ............................................... AAGCTTACTTTGGATGAGAACGGTTATAC 153 47 100.0 30 ............................................... TACCTTGCGCTTGTAAAAGACGGCCAGCAA 230 47 100.0 30 ............................................... AGATAGCAGAGCTTATATACGCTTCCAAGA 307 47 100.0 29 ............................................... CTAGCCGAAATAAAATATGGGTTTCACCC 383 47 100.0 29 ............................................... TGTTTAGAACTGTCTCGCCTACTATGTCA 459 44 93.6 0 ............................................--- | ========== ====== ====== ====== =============================================== ============================== ================== 7 47 98.8 30 GTTGTGATTTGCTTTCATTTTAGTATCTTTGAACCATTGGAAACAGT # Left flank : | # Right flank : | # Questionable array : NO Score: 6.20 # Score Detail : 1:0, 2:3, 3:0, 4:0.94, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTGTGATTTGCTTTCATTTTAGTATCTTTGAACCATTGGAAACAGT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:68.09%AT] # Reference repeat match prediction: F [matched GTTGTGATTTGCTTTCAAATTAGTATCTTTGAACCATTGGAAACAGC with 96% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-1.30,-1.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [1-1] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [0.0-0.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.87,0 Confidence: HIGH] # Array family : II-C [Matched known repeat from this family], //