Array 1 199-51 **** Predicted by CRISPRDetect 2.4 *** >NZ_RDPQ01001394.1 Vibrio anguillarum strain 171124-1/1A contig_1404, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 198 28 100.0 32 ............................ CGTTTAACCACTGTTTAAAAGGAGTTCACTGT 138 28 100.0 32 ............................ AATCTGAAGCAGCTCGTGTGCTTGGGTTGAGC 78 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 3 28 100.0 32 GTTCACTGCCGTATAGGCAGCTTAGAAA # Left flank : GTATAGGCAGCTTAGAAATCACAGTGAGGGCACCATTTCTGCAAGCCTA # Right flank : ACAAGAGATTCGCGATCAGCTTCATGAGTGGATGTTCACTGCCGTATAGGC # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGTATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:53.57%AT] # Reference repeat match prediction: R [matched GTTCACTGCCGTATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.70,-8.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [41.7-43.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.87 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 53-203 **** Predicted by CRISPRDetect 2.4 *** >NZ_RDPQ01000513.1 Vibrio anguillarum strain 171124-1/1A contig_514, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ =================================== ================== 53 28 100.0 35 ............................ TATGGCACCTCGACACGCTTCATCGTCTGGATTCA 116 28 100.0 32 ............................ GAGGCGCGGCGGCGTAGGAGTCTTTAAAGCTT 176 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ =================================== ================== 3 28 100.0 34 GTTCACTGCCGTATAGGCAGCTTAGAAA # Left flank : CCGTATAGGCAGCTTAGAAATTCCCAATACCTATCTTGCTCGTTCCAGAGCAG # Right flank : GCTAGTGAAGATGTCGCAACAG # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGTATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:53.57%AT] # Reference repeat match prediction: F [matched GTTCACTGCCGTATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.00,-7.70] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [46.7-18.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.14,0 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], //