Array 1 4-568 **** Predicted by CRISPRDetect 2.4 *** >NZ_JAHHFU010000026.1 Streptococcus mutans strain E681 NODE_26_length_568_cov_767.912779, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ================================ =================================== ================== 4 32 100.0 35 ................................ ATAAAAATCAGTCTCCATAAAATCGTTGACCGACC 71 32 100.0 35 ................................ CTGAATATGAGGTGACTCATGGATGATTTACAACG 138 32 100.0 34 ................................ ACGTCTTTCCAATACACGACCAATAGATTCTAAA 204 32 100.0 34 ................................ ATTGCCATGGTTTGAAGCTGTTCAAGATTTTAAA 270 32 100.0 34 ................................ ATATATCTAAGGATTTGAAGGAAGTTGCTAAACA 336 32 100.0 35 ................................ ATATTTTTCGGGTATGAAAGCTTTATGCATATAAT 403 32 100.0 35 ................................ ACGACATCAAGGCGGAGATGTCATTTCACTTGTTG 470 32 100.0 35 ................................ ACGACATCAAGGCGGAGATGTCATTTCACTTGTTG 537 32 100.0 0 ................................ | ========== ====== ====== ====== ================================ =================================== ================== 9 32 100.0 35 GTCGCACCCTTCACGGGTGCGTGGATTGAAAT # Left flank : TATG # Right flank : | # Questionable array : NO Score: 9.26 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCCTTCACGGGTGCGTGGATTGAAAT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: F Score: 4.5/4.5 # A,T distribution in repeat prediction: R [6,8] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTCGCACCCTTCGCGGGTGCGTGGATTGAAAT with 97% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-6.40,-5.50] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [5.0-0.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [9.37,0.37 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 1922-34 **** Predicted by CRISPRDetect 2.4 *** >NZ_JAHHFU010000018.1 Streptococcus mutans strain E681 NODE_18_length_6821_cov_434.581085, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ================================ ==================================== ================== 1921 32 100.0 34 ................................ ATTTAACATGATAGTCCTTCTTTCTGCATTGTCT 1855 32 100.0 36 ................................ ATATCTATCAATCAATCTTAGACGACACAGATCAAA 1787 32 100.0 34 ................................ CCAAACAACACGACCACCAACATAATCAAAACCA 1721 32 100.0 33 ................................ TTAGCAATTTGTTTCGTGATTGCAAAAAGTCCA 1656 32 100.0 34 ................................ TGGTACGTTAAAGCGCACCCAACCACCAAACCAA 1590 32 100.0 33 ................................ TGATTTCAATATCTCTTTTAAATCTCCATGAAT 1525 32 100.0 35 ................................ AATTTAAAGTTTAGTTTGATTATTTCTTTTGTGAG 1458 32 100.0 34 ................................ TTGGATAGGTCACACCGTTAATCCAGTCAGTGAG 1392 32 100.0 33 ................................ TTTCGTCCGAATTGGTTATTAATTGCCAGATTA 1327 32 100.0 34 ................................ ATTTAAGACAATTGCAGACCAACAAGCAAATCTC 1261 32 100.0 34 ................................ TGTTAAAGTCTCTGAATAGTCATATATGTAAAAC 1195 32 100.0 35 ................................ TGAAGTCTGCTGGTATTCTTTTCAAGGGTCTTGTA 1128 32 100.0 35 ................................ AAAAAAGCTGTGTCATTTTGCTTCATCAGCATAGA 1061 32 100.0 33 ................................ TTCGCCGTCCATAGTATCGCCATGAGTAGCAGT 996 32 100.0 35 ................................ AGAGCTCCGCTAACAAAACTGCCGATAGACTTGCC 929 32 100.0 34 ................................ TTTCTTGTTTTCTCGCCCTATTCCGCGCGGGTCT 863 32 100.0 34 ................................ AACGACCTTCCATTCGAGTATTCTCAAGCAATTT 797 32 100.0 35 ................................ ATATTCATAAAAGGCGTCACGAAAGCTGCAATTAC 730 32 100.0 35 ................................ TTATATAACTCTGTTAAAACAACACCTACTGCAAC 663 32 100.0 35 ................................ TTTATATTCTCTTTGCAGAGTAGCAAGACCTGATT 596 32 100.0 34 ................................ AAGAAATTCAGGTGGATAAAGAACTTAATGACTA 530 32 100.0 35 ................................ TGTATGGAATACATTGACATACCAATGATACTCAT 463 32 100.0 35 ................................ ATAAAAATCAGTCTCCATAAAATCGTTGACCGACC 396 32 100.0 34 ................................ TTCATTTTACATATTTATTATACCACGCATTGCG 330 32 100.0 34 ................................ TTATAGAGAACAGTCAAAGCCACTCCCACAGTGG 264 32 100.0 35 ................................ AATAATAGTTTCTTCTCTTGACCAATTATCATAAA 197 32 100.0 35 ................................ ATCTATTTCGACCAAAACACAAAAACGCTTGACCT 130 32 100.0 33 ................................ AATTTGCGCTCGCTCCTCTCAAGGTGATTGGCG 65 32 100.0 0 ................................ | ========== ====== ====== ====== ================================ ==================================== ================== 29 32 100.0 34 GTCGCACCCTTCACGGGTGCGTGGATTGAAAT # Left flank : TAAAGCTATTCGTGGAGAATTAGAATCTTATCCACCATTCTTAATCTAGGAGCAAATTTATGATGGTTTTAGTGACTTATGATGTCAATACGGAGACTGTAGCAGGAAAGAAACGACTACGACATGTCGCAAAACTCTGTGTTGATTATGGTCAGCGTGTGCAACATTCGGTTTTTGAGTGTTCAGTGACACCAGCCGAATTTGTAGAGATTAAAAATGAACTCTCAACAATCATTGACCAAAAATCAGACAGCATCCGATTTTATTTACTTGGCAAAAATTGGCAAAATCGGGTAGAAACGATGGGCCGAGATGACAGTTATGACCCCGATGTGGGGGTACTGCTTTTATAAAAATTTGTGTGCGAATCTGGGTTGCACATCAAAACCAGAGACATTCGCGCACAAAACCAGAACTATAGTGATAAAAATTCAGTTTTTATTGAGCCAATTGGTTTAATAAATTCTCGATTTTAGTCACAAACGGTGCAACTACGCGCC # Right flank : TAATTTGCGCTCGCTCCTCTCAAGGTGATTGGCG # Questionable array : NO Score: 9.26 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCCTTCACGGGTGCGTGGATTGAAAT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: R Score: 4.5/4.5 # A,T distribution in repeat prediction: F [8,6] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTCGCACCCTTCGCGGGTGCGTGGATTGAAAT with 97% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-5.50,-6.40] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [25.0-60.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.37,9.64 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 1-163 **** Predicted by CRISPRDetect 2.4 *** >NZ_JAHHFU010000104.1 Streptococcus mutans strain E681 NODE_105_length_222_cov_8.741497, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ================================ ================================== ================== 1 32 100.0 33 ................................ AATTTGCGCTCGCTCCTCTCAAGGTGATTGGCG 66 32 100.0 34 ................................ AATTTGCGCTCGCTCCTCTCAAGGTGATTGGCGC 132 32 100.0 0 ................................ | ========== ====== ====== ====== ================================ ================================== ================== 3 32 100.0 34 GTCGCACCCTTCACGGGTGCGTGGATTGAAAT # Left flank : | # Right flank : TTTAGAAACCTTACCGCCATTTACATAGCCGTATGTCGCACCCTTCACGGGTGCGTGGG # Questionable array : YES [Potential tandem repeat] Score: 5.27 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:-3, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCCTTCACGGGTGCGTGGATTGAAAT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: F Score: 4.5/4.5 # A,T distribution in repeat prediction: R [8,12] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTCGCACCCTTCGCGGGTGCGTGGATTGAAAT with 97% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-7.00,-5.50] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-10] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [0.0-31.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [9.78,0.64 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 11-174 **** Predicted by CRISPRDetect 2.4 *** >NZ_JAHHFU010000105.1 Streptococcus mutans strain E681 NODE_106_length_214_cov_565.438849, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ================================ ================================== ================== 11 32 100.0 34 ................................ AATTTGCGCTCGCTCCTCTCAAGGTGATTGGCGC 77 32 100.0 34 ................................ TTTAGAAACCTTACCGCCATTTACATAGCCGTAT 143 32 100.0 0 ................................ | ========== ====== ====== ====== ================================ ================================== ================== 3 32 100.0 34 GTCGCACCCTTCACGGGTGCGTGGATTGAAAT # Left flank : GTGATTGGCGG # Right flank : ATAAAAATCAGTCTCCATAAAATCGTTGACCGACCGTCGC # Questionable array : NO Score: 8.67 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCCTTCACGGGTGCGTGGATTGAAAT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: F Score: 4.5/4.5 # A,T distribution in repeat prediction: R [6,8] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTCGCACCCTTCGCGGGTGCGTGGATTGAAAT with 97% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-6.40,-5.50] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [6.7-38.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [9.37,0.64 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 2-166 **** Predicted by CRISPRDetect 2.4 *** >NZ_JAHHFU010000106.1 Streptococcus mutans strain E681 NODE_107_length_207_cov_16.151515, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ================================ =================================== ================== 2 32 93.8 35 .....A...T...................... AGAGCTCCGCTAACAAAACTGCCGATAGACTTGCC 69 32 100.0 34 ................................ TTTATTGTTTTGTCGCCCGATTCCGCGCGGGGCT 135 32 100.0 0 ................................ | ========== ====== ====== ====== ================================ =================================== ================== 3 32 97.9 35 GTCGCCCCCGTCACGGGTGCGTGGATTGAAAT # Left flank : TG # Right flank : AAAGACCATCCATTCGAGTATTATCAAGCAAATTGTCGCAC # Questionable array : NO Score: 8.26 # Score Detail : 1:0, 2:3, 3:3, 4:0.90, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:0.69, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCCCCCGTCACGGGTGCGTGGATTGAAAT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: F Score: 4.5/4.5 # A,T distribution in repeat prediction: R [5,7] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTCGCTCCCTTCACGGGAGCGTGGATTGAAAT with 91% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [-5.10,-5.20] Score: 0/0.37 # Array degeneracy analysis prediction: R [2-0] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [1.7-41.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [9,1.05 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], //