Array 1 37-270 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_POOM01000215.1 Streptococcus suis strain 789 SS_0789_Contig215, whole genome shotgun sequence		Array_Orientation: Forward

  Position	Repeat	   %id	Spacer	Repeat_Sequence                     	Spacer_Sequence               	Insertion/Deletion
==========	======	======	======	====================================	==============================	==================
        37	    36	 100.0	    30	....................................	CCAGCAGTAACACTAATCTATATCTGTGTA	
       103	    36	 100.0	    30	....................................	TAAATAAAATTTTATATTAATATCTGATAT	
       169	    36	 100.0	    30	....................................	GTATGGTGATGGTCAATGCTATGCTACTAC	
       235	    36	 100.0	     0	....................................	|                             	
==========	======	======	======	====================================	==============================	==================
         4	    36	 100.0	    30	GTTTTAGAGCTGTGCTGTTTCGAATGGTTTCAAAAC	                              	       

# Left flank :   CAAAACAATTACAACTATTGCAACAACCCCTGCCATG
# Right flank :  TAA

# Questionable array : NO	 Score: 5.86
# 	Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTTTTAGAGCTGTGCTGTTTCGAATGGTTTCAAAAC
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     NA [Repeat is AT rich:61.11%AT]
# 	Reference repeat match prediction:         F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 98% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  F [-2.80,-0.20] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      NA [0-0] Score: 0/0.41
# 	AT richness analysis in flanks prediction: F [36.7-5.0]%AT Score: 0.27/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         F [5.14,0   Confidence: HIGH] 

# Array family : II-A/C [Matched known repeat from this family],   
//


Array 1 53-286 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_POOM01000084.1 Streptococcus suis strain 789 SS_0789_Contig84, whole genome shotgun sequence		Array_Orientation: Forward

  Position	Repeat	   %id	Spacer	Repeat_Sequence                     	Spacer_Sequence               	Insertion/Deletion
==========	======	======	======	====================================	==============================	==================
        53	    36	 100.0	    30	....................................	CGTAGCTTTGCCATTAATAACTGCCATGAC	
       119	    36	 100.0	    30	....................................	AATTACAACTATTGCAACAACCCCTGCCAT	
       185	    36	 100.0	    30	....................................	GCGTGACAGACGTATGCGCTGTGATATGTG	
       251	    36	 100.0	     0	....................................	|                             	
==========	======	======	======	====================================	==============================	==================
         4	    36	 100.0	    30	GTTTTAGAGCTGTGCTGTTTCGAATGGTTTCAAAAC	                              	       

# Left flank :   GCTGTTTCGAATGGTTTCAAAACTTTAACTATCTAAATTCTTTTTATAGAGGG
# Right flank :  TTTTTCAGCATAAGTTAATTTTATAGTAGCGTTTTAGAGCTGT

# Questionable array : NO	 Score: 5.86
# 	Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTTTTAGAGCTGTGCTGTTTCGAATGGTTTCAAAAC
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     NA [Repeat is AT rich:61.11%AT]
# 	Reference repeat match prediction:         F [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 98% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  F [-2.80,-0.20] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      NA [0-0] Score: 0/0.41
# 	AT richness analysis in flanks prediction: F [61.7-51.7]%AT Score: 0.27/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         F [5.14,0   Confidence: HIGH] 

# Array family : II-A/C [Matched known repeat from this family],   
//