Array 1 309-9 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_FJOP01000061.1 Streptococcus agalactiae isolate SA2, whole genome shotgun sequence		Array_Orientation: Reverse

  Position	Repeat	   %id	Spacer	Repeat_Sequence                     	Spacer_Sequence               	Insertion/Deletion
==========	======	======	======	====================================	==============================	==================
       308	    36	 100.0	    30	....................................	CAGAAGCTATTACGCAATATATGTCATACT	
       242	    36	 100.0	    30	....................................	TTTTCAAAAGATAAAACATTTAAAAGACTA	
       176	    36	 100.0	    30	....................................	CATTTTTTGTAATTCTTCAACATTGTGACA	
       110	    36	 100.0	    30	....................................	AAAGACTTAATAAAGAATTTGACAATGATC	
        44	    36	 100.0	     0	....................................	|                             	
==========	======	======	======	====================================	==============================	==================
         5	    36	 100.0	    30	GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC	                              	       

# Left flank :   GTCTAAC
# Right flank :  CTACTTGAC

# Questionable array : NO	 Score: 6.06
# 	Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     NA [Repeat is AT rich:58.33%AT]
# 	Reference repeat match prediction:         R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  R [-0.20,-4.70] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      NA [0-0] Score: 0/0.41
# 	AT richness analysis in flanks prediction: NA [8.3-6.7]%AT Score: 0/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         R [0,4.87   Confidence: HIGH] 

# Array family : II-A/C [Matched known repeat from this family],   
//


Array 1 309-9 		**** Predicted by CRISPRDetect 2.4 *** 
>NZ_FJOP01000123.1 Streptococcus agalactiae isolate SA2, whole genome shotgun sequence		Array_Orientation: Reverse

  Position	Repeat	   %id	Spacer	Repeat_Sequence                     	Spacer_Sequence               	Insertion/Deletion
==========	======	======	======	====================================	==============================	==================
       308	    36	 100.0	    30	....................................	ATGGCAATACAATCCTTATCGAGGTTCCAG	
       242	    36	 100.0	    30	....................................	ACCACTTTCAAGAGAAACAGGCGGACTTGA	
       176	    36	 100.0	    30	....................................	GACAGTAAAAGAATACAATTTAAGGATTAA	
       110	    36	 100.0	    30	....................................	TTTAGCGCTTATGTTAAACGTGAGGTAGCT	
        44	    36	 100.0	     0	....................................	|                             	
==========	======	======	======	====================================	==============================	==================
         5	    36	 100.0	    30	GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC	                              	       

# Left flank :   GTCTAAC
# Right flank :  CAAACGTTA

# Questionable array : NO	 Score: 6.06
# 	Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1,
# 	Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats),
# Primary repeat :     GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC
# Alternate repeat :   NA

# Directional analysis summary from each method:
# 	Motif ATTGAAA(N) match prediction:         NA Score: 0/4.5
# 	A,T distribution in repeat prediction:     NA [Repeat is AT rich:58.33%AT]
# 	Reference repeat match prediction:         R [matched GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC with 100% identity] Score: 4.5/4.5
# 	Secondary Structural analysis prediction:  R [-0.20,-4.70] Score: 0.37/0.37
# 	Array degeneracy analysis prediction:      NA [0-0] Score: 0/0.41
# 	AT richness analysis in flanks prediction: NA [10.0-6.7]%AT Score: 0/0.27
# 	Longer leader analysis prediction:         NA 
# 	----------------------------------------------------------------------------
# 	Final direction:         R [0,4.87   Confidence: HIGH] 

# Array family : II-A/C [Matched known repeat from this family],   
//