Array 1 1-226 **** Predicted by CRISPRDetect 2.4 *** >NZ_JTIU01000040.1 Lacticaseibacillus rhamnosus strain Lrh10 Lrh10_contig00043, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 1 27 75.0 29 ---------........................... AAGCAACATATCAATCAAGCCGAAAAAAG 57 36 100.0 30 .................................... TGATGACGAAGTGAGTTTGCCCACCGCTTG 123 36 100.0 30 .................................... ACTCGGGTATTGACAAAGATCGACGCGGCA 189 36 86.1 0 .......................AA.C....T...G | C,G [214,220] ========== ====== ====== ====== ==================================== ============================== ================== 4 36 90.3 30 GTCTCAGGTAGATGTCAGATCAATCAGTTCAAGAAC # Left flank : | # Right flank : GACTCACCTCATAAATGCTATGCAAATCCCAAAAGAAGGCAACAGCAATGTCAAAAGCGAAACTAATCCTTTCGCCAGTATTTTACACTGATCTCAAAGAAATCCGTCACATGTACCAACAGGCGTTCAAATCACTTTACGGCAAATATCAAGATCGGGAAACCAATCCCTACTGTGAATCGTTGAAAAGCTTACAGAAAAAGTTCAAACGGCCTAACAATGCCTTCTTCTTTATAACCGTTGAAGATAAACACATAGGCCTGATTCGCGTTGTAACAGATCTCAAAAATTCGGCAGCCCGTATTTCACCATTTTTAATCTTGCCGTTTTATCAAGGAAAGGGATACGCTCAGCTCGGACTACAGTTGATTGAAGAACAGTTTCCGCTCATTCAAACATGGTATGTAGACACGATTGCGGAAGAACCCAAGTTGGTACATTTGTATCGCAAAGTCGGTTTTCAGCAGCTACCAGATCGGGAAACGACGATTAATGAGCAT # Questionable array : NO Score: 5.37 # Score Detail : 1:0, 2:3, 3:0, 4:0.51, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCTCAGGTAGATGTCAGATCAATCAGTTCAAGAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:62.96%AT] # Reference repeat match prediction: F [matched GTCTCAGGTAGATGTCAGATCAATCAGTTCAAGAGC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [0.00,0.00] Score: 0/0.37 # Array degeneracy analysis prediction: F [0-7] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [0.0-0.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.91,0 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 461-29 **** Predicted by CRISPRDetect 2.4 *** >NZ_JTIU01000071.1 Lacticaseibacillus rhamnosus strain Lrh10 Lrh10_contig00079, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 460 36 100.0 30 .................................... GACAACAGACTCCGTCAACATCAGTCTTAA 394 36 100.0 30 .................................... ATAAACATCGTATGCGAATCGTAACAACGT 328 36 100.0 30 .................................... AGTTGATTGAGGCGCGGATGTACATTCCTG 262 36 100.0 30 .................................... CCGTTTTGGTTGCAAAACGAACCGATTACG 196 36 100.0 30 .................................... AAGGTGTACTGCTTAGCTGACTCCCACGTG 130 36 100.0 30 .................................... CTCGTGACTTGTCGTGATATGCATACGCGC 64 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 7 36 100.0 30 GTCTCAGGTAGATGTCAGATCAATCAGTTCAAGAAC # Left flank : GATTTGCGAGATGTCGCGATAAGAAGTC # Right flank : CGAAAGTTCTTTAAGTTGACCACTCATTT # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCTCAGGTAGATGTCAGATCAATCAGTTCAAGAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTCTCAGGTAGATGTCAGATCAATCAGTTCAAGAGC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [0.00,-2.50] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [31.7-26.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.87 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 42-341 **** Predicted by CRISPRDetect 2.4 *** >NZ_JTIU01000074.1 Lacticaseibacillus rhamnosus strain Lrh10 Lrh10_contig00084, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== ============================== ================== 42 36 100.0 30 .................................... GGCAATTTTAAAGCCGTGACCGATGCCACG 108 36 100.0 30 .................................... ATGACGCAGTTGGCGAAACCTTTGCACGTT 174 36 100.0 30 .................................... TCGCTGACATTGACCATCAACGGCGCCGAG 240 36 100.0 30 .................................... GCGTGTTAGTCGCTTGTGTGGCTTACCGTT 306 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== ============================== ================== 5 36 100.0 30 GTCTCAGGTAGATGTCAGATCAATCAGTTCAAGAAC # Left flank : AGTTCAAGAACTTTTATGATGGGCTTGTATTTTCCCAAATAG # Right flank : GCGGCATCTTCAAAATCAAAACGACGCGCAGTCTCAGGTAGATGTCAGATCAA # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCTCAGGTAGATGTCAGATCAATCAGTTCAAGAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: F [matched GTCTCAGGTAGATGTCAGATCAATCAGTTCAAGAGC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-2.50,0.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [46.7-46.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.87,0 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], // Array 1 205-36 **** Predicted by CRISPRDetect 2.4 *** >NZ_JTIU01000076.1 Lacticaseibacillus rhamnosus strain Lrh10 Lrh10_contig00089, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ==================================== =============================== ================== 204 36 100.0 31 .................................... TTTAGAATACGATTATAAGACAGTAGTTTGG 137 36 100.0 30 .................................... AGTAAGGTAGCCAAATACAACCATAAGGGT 71 36 100.0 0 .................................... | ========== ====== ====== ====== ==================================== =============================== ================== 3 36 100.0 31 GTCTCAGGTAGATGTCAGATCAATCAGTTCAAGAAC # Left flank : CC # Right flank : CAACTATCTAACACGCTATACACAGAATGGCGTCTC # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCTCAGGTAGATGTCAGATCAATCAGTTCAAGAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.33%AT] # Reference repeat match prediction: R [matched GTCTCAGGTAGATGTCAGATCAATCAGTTCAAGAGC with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [0.00,-2.50] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [33.3-0.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.27,4.87 Confidence: HIGH] # Array family : II-A/C [Matched known repeat from this family], //