Array 1 41-309 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000193.1 Acinetobacter sp. CFCC 10889 contig00194, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================= ================== 41 28 100.0 32 ............................ AGAGCATCACTTCAAGCCCATCTCAAGTGATG 101 28 100.0 33 ............................ AATAATATTTTTGTTGGACTTAACAAGTTTTGT 162 28 100.0 32 ............................ AACAAGAACAGGGTGTAACAAAACATACAGGA 222 28 100.0 32 ............................ AATAAAAAAAGGGGAAGTCGATGTGATCCTCC 282 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================= ================== 5 28 100.0 32 GTTCACTGCCATATAGGCAGCTTAGAAA # Left flank : CTTAGAAATCTGCCAATAAACAATAAAGCTGGAGGGATCGG # Right flank : ATACGGTATGGCAAATGATGCATTTGAAACAAGTTCACTGCCATATAGGCAG # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCATATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.62%AT] # Reference repeat match prediction: F [matched GTTCACTGCCATATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.20,-8.40] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [40.0-50.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.5,0.64 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 41-308 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000194.1 Acinetobacter sp. CFCC 10889 contig00195, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 41 28 100.0 32 ............................ ACTTAATATCAGGGTGCACACCCGACCAATCG 101 28 100.0 32 ............................ TTAAAGATAGCGAGTATGTGAATGCAAATCCG 161 28 100.0 32 ............................ TGCGATTTCAGCTTGTTTTAGAGCTTCTTTTC 221 28 100.0 32 ............................ AGATGAGAACATTTTAAATCCCAAAACTTTGT 281 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 5 28 100.0 32 GTTCACTGCCATATAGGCAGCTTAGAAA # Left flank : CTTAGAAAAATCCCTCATCCCAAATCCTATCAGCCATAAAG # Right flank : TCAAGCCACGCGGCACGCTTATTCTTGTTTGTGTTCACTGCCATATAGGCAG # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCATATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:57.14%AT] # Reference repeat match prediction: F [matched GTTCACTGCCATATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.20,-8.40] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [41.7-43.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.5,0.37 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 262-54 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000205.1 Acinetobacter sp. CFCC 10889 contig00206, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 261 28 100.0 32 ............................ TTCAAAGAACAAGCAAAGCTACCAAGTGTTGT 201 28 100.0 32 ............................ GCATGTAATCTTCACACTATCGCCAATGGCTT 141 28 100.0 32 ............................ AAGATTTTAAAGATGATGCGTTTGCTTCACCG 81 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 4 28 100.0 32 GTTCACTGCCATATAGGCAGCTTAGAAA # Left flank : CTTAGAAAATTGGTTGCATTTTTAACGTATTTCTGTGTG # Right flank : AAGTAATTGTGTATTTAATATCTTGGTTTTTTCCGTTCACTGCCATATAGGCAG # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCATATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:57.14%AT] # Reference repeat match prediction: R [matched GTTCACTGCCATATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.40,-7.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [58.3-46.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.64,4.5 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 41-308 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000198.1 Acinetobacter sp. CFCC 10889 contig00199, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 41 28 100.0 32 ............................ AATAATAATTGACAACACCAAACCAACGAATA 101 28 100.0 32 ............................ ATTAAATCCTTGTGATCTAACAAACTTTTCAA 161 28 100.0 32 ............................ TTGATATTTTGGAAATGTCGCCAAAATTCAGG 221 28 100.0 32 ............................ TGCAATCGCTGAGTGAGTTACACCGATTGAAG 281 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 5 28 100.0 32 GTTCACTGCCATATAGGCAGCTTAGAAA # Left flank : CTTAGAAAGCACCTACACCGATTGAATCGTAGATGATGAAG # Right flank : AAGGGTAAAAAAGAATCTCAGAGAGATG # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCATATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:57.14%AT] # Reference repeat match prediction: F [matched GTTCACTGCCATATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.20,-8.40] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [40.0-30.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.77,0.37 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 256-48 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000206.1 Acinetobacter sp. CFCC 10889 contig00207, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 255 28 100.0 32 ............................ AAAAAGCACAAGTCGTTAGATAATCAATACAG 195 28 100.0 32 ............................ ATTTGCTTTTTGTGTGGTCGTCACGCTTCAAT 135 28 100.0 32 ............................ TGTATTTAAAACTATTACTGCATCTTTTCAAG 75 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 4 28 100.0 32 GTTCACTGCCGTATAGGCAGCTTAGAAA # Left flank : AGGCAGCTTAGAAATACTGAATCAGGTAGTAGGCTAGGGTCGTTC # Right flank : AGTCAAGCATGTTTGCTGACATATCGTTACGTGTGTTCACTGCCGTAT # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGTATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:53.57%AT] # Reference repeat match prediction: R [matched GTTCACTGCCGTATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.70,-8.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [43.3-41.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0,4.87 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 259-51 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000207.1 Acinetobacter sp. CFCC 10889 contig00208, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 258 28 100.0 32 ............................ TTTGTCTGCAACTTTGCCATGGATGTATGGTA 198 28 100.0 32 ............................ ACAACCGAAGAAAACAAGTGTTTTGACGTGGA 138 28 100.0 32 ............................ AGCTCTAACTCACGCTCATAAACACCAAAAGC 78 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 4 28 100.0 32 GTTCACTGCCATATAGGCAGCTTAGAAA # Left flank : CTTAGAAAAATTATCTGCAATGCGAGATAAATTACGCCA # Right flank : AACTCCCAAATCCAAAAATCAGCAGGGATTTTTTGTTCACTGCCATATAGG # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCATATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:57.14%AT] # Reference repeat match prediction: R [matched GTTCACTGCCATATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.40,-7.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [50.0-45.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.37,4.5 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 258-50 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000208.1 Acinetobacter sp. CFCC 10889 contig00209, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 257 28 100.0 32 ............................ ATCAGCTTCAAGCCTTGGTATCAACTCACCCC 197 28 100.0 32 ............................ ATTTTTATCAACAATAAACTTACCTGTTAAAT 137 28 100.0 32 ............................ AACAAAAAAAGTTGCAGATAACAGTTTTACAC 77 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 4 28 100.0 32 GTTCACTGCCATATAGGCAGCTTAGAAA # Left flank : CTTAGAAAACATCCTGAGTATTTCTAAAAAAGTTGAGAA # Right flank : AGGGAAGCGCTCAAATGTATAAGCTGTTCCTGTGTTCACTGCCATATAGG # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCATATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:57.14%AT] # Reference repeat match prediction: R [matched GTTCACTGCCATATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.40,-7.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [43.3-46.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.37,4.5 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 212-3 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000212.1 Acinetobacter sp. CFCC 10889 contig00213, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================= ================== 211 28 100.0 32 ............................ ATGAACCCATCCCAATACACCCAACTCACTAA 151 28 100.0 32 ............................ GTAATCTTCAAATGGGAGTTGTTTATCAGGCA 91 28 100.0 33 ............................ TTTTGAATGTTGATTTGAATCACTGAATTAGCA 30 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================= ================== 4 28 100.0 33 GTTCACTGCCATATAGGCAGCTTAGAAA # Left flank : CTTAGAAAAACAATTTCAGTTAATGTCGCCCAAGTTCCT # Right flank : ATT # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCATATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:57.14%AT] # Reference repeat match prediction: R [matched GTTCACTGCCATATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.40,-7.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [3.3-41.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.37,4.77 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 41-248 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000213.1 Acinetobacter sp. CFCC 10889 contig00214, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 41 28 100.0 32 ............................ AAATGTTCTACCAGTGCTTCTAACTCTGCCAT 101 28 100.0 32 ............................ GCAAAGGATGTATAGGATTGCTGTGATCATTG 161 28 100.0 32 ............................ GTTTCCCTGCAAAATCAAAAGAAACGTCAGCC 221 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 4 28 100.0 32 GTTCACTGCCATATAGGCAGCTTAGAAA # Left flank : CTTAGAAATTTTTCTAACTCAGCACGTAAGCGATCTGATTG # Right flank : AA # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCATATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:57.14%AT] # Reference repeat match prediction: F [matched GTTCACTGCCATATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.20,-8.40] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [43.3-3.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.77,0.37 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 48-195 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000214.1 Acinetobacter sp. CFCC 10889 contig00215, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 48 28 100.0 32 ............................ ACTCATTTCAGGCAGTATTACATTATGAAGTT 108 28 100.0 32 ............................ TTGTGAGCATTCATCCAAACCTTTAAAGGCGT 168 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 3 28 100.0 32 GTTCACTGCCATATAGGCAGCTTAGAAA # Left flank : AGGCAGCTTAGAAAAGAAGCATTGCTTGATGAATGGCTTGATATCATG # Right flank : ATGCTGCCCACTTGCAATCCGCCCACTCATCAGTTCACTGCCATATAGGCAG # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCATATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.62%AT] # Reference repeat match prediction: F [matched GTTCACTGCCATATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.80,-9.80] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [46.7-40.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.5,0.37 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 203-1 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000215.1 Acinetobacter sp. CFCC 10889 contig00216, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================= ================== 202 28 100.0 33 ............................ ATATTTCAAGTAAGCATTTAGCATTGCTTTGTA 141 28 100.0 32 ............................ TTTGAGTAGGCTCTAACGGAACTAATATATGT 81 28 100.0 33 ............................ CATAACCACTAATAGCTTGCTATCATCTAATGT 20 20 71.4 0 ....................-------- | ========== ====== ====== ====== ============================ ================================= ================== 4 28 92.8 33 GTTCACTGCCATATAGGCAGCTTAGAAA # Left flank : CTTAGAAAAAGAACAACAAGCCCAGAATCAAGCGGTACA # Right flank : G # Questionable array : NO Score: 5.50 # Score Detail : 1:0, 2:3, 3:0, 4:0.64, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCATATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:56.00%AT] # Reference repeat match prediction: R [matched GTTCACTGCCATATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [0.00,0.00] Score: 0/0.37 # Array degeneracy analysis prediction: F [1-5] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [0.0-33.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.41,4.77 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 201-1 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000217.1 Acinetobacter sp. CFCC 10889 contig00218, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 200 28 100.0 32 ............................ TGAATGGGCTGACCCTTTTGATGATTTTGATA 140 28 100.0 32 ............................ AAGCTTCATTTGATCCGAGCCATTGAGCTTTT 80 28 100.0 32 ............................ TGTTAATGCTGAGCGGTCAGCGACGAAAGAGA 20 20 71.4 0 ....................-------- | ========== ====== ====== ====== ============================ ================================ ================== 4 28 92.8 32 GTTCACTGCCGTATAGGCAGCTTAGAAA # Left flank : CTTAGAAAATACCCTGTTAAACAAAACAACAGTCGTGGT # Right flank : G # Questionable array : NO Score: 5.50 # Score Detail : 1:0, 2:3, 3:0, 4:0.64, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGTATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: F [6,5] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTTCACTGCCGTATAGGCAGCTTAGAAG with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [0.00,0.00] Score: 0/0.37 # Array degeneracy analysis prediction: R [2-0] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [0.0-40.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.37,5.18 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 196-47 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000216.1 Acinetobacter sp. CFCC 10889 contig00217, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================= ================== 195 28 100.0 33 ............................ TAGGTAAATTTTATCAAACGTGTCAGGGTGTTT 134 28 100.0 32 ............................ TGATTCTTAAACTCAATAGTAACCTCATGACT 74 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================= ================== 3 28 100.0 33 GTTCACTGCCGTATAGGCAGCTTAGAAA # Left flank : AGGCAGCTTAGAAATTATGGGTGGACGTATGTCGTCCAAGTCTTG # Right flank : AAGATAATCTTTCAAATTATAAAAGTCCTGTTTGTTCACTGCCGTAT # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGTATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:55.17%AT] # Reference repeat match prediction: R [matched GTTCACTGCCGTATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-9.10,-8.60] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: F [53.3-40.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [1.05,4.5 Confidence: MEDIUM] # Array family : I-F [Matched known repeat from this family], // Array 1 198-50 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000219.1 Acinetobacter sp. CFCC 10889 contig00220, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 197 28 100.0 32 ............................ ATCACAAAACTTGCGATGGCTGTATAAAATGG 137 28 100.0 32 ............................ GTCATGGAACTCTTGCAAATCATTGCTTAACA 77 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 3 28 100.0 32 GTTCACTGCCATATAGGCAGCTTAGAAA # Left flank : CTTAGAAATTTGTTGACATCCTGAAGCATTGGATTTGCA # Right flank : AATACATTCCGGTATTAATTAGTGATTCCCATAGTTCACTGCCATATAGG # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCATATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:57.14%AT] # Reference repeat match prediction: R [matched GTTCACTGCCATATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.40,-7.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [51.7-41.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.64,4.5 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 197-48 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000221.1 Acinetobacter sp. CFCC 10889 contig00222, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================= ================== 196 28 100.0 32 ............................ AATCTTCAGGTTCATACTTTTTAATTAGATGA 136 28 100.0 33 ............................ ATTTATTTTTTACATAAAAATTGCCTGAAACTT 75 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================= ================== 3 28 100.0 33 GTTCACTGCCATATAGGCAGCTTAGAAA # Left flank : CTTAGAAATAAATGTAGGTGGAAAGCGCAATGCAAATGC # Right flank : AATTTGCATCTGCTGCATTATTGCCTTGTGAACGTTCACTGCCATATA # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCATATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.62%AT] # Reference repeat match prediction: R [matched GTTCACTGCCATATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.40,-7.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [45.0-41.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.37,4.5 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 54-322 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000047.1 Acinetobacter sp. CFCC 10889 contig00048, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 54 28 100.0 32 ............................ TTGCATCATTGCTCTACGTTTCTCAACCGCTT 114 28 100.0 32 ............................ TTTATGACAACCAACGTATGCCTTACATGGCA 174 28 100.0 32 ............................ TGATGGTTATTTCAATCAAACATATACAGGGC 234 28 100.0 32 ............................ AACAAGAAATGCGTATATTTCACCATCATATA 294 28 96.4 0 ........................A... | C [321] ========== ====== ====== ====== ============================ ================================ ================== 5 28 99.3 32 GTTCACTGCCATATAGGCAGCTTAGAAA # Left flank : GCCATATAGGCAGCTTAGAAAATCATTAATCCGACTCCAGAGTGTCGACTCAGG # Right flank : ATAAATTAACTTTTTATTCAACTCTCATTTTTACTGCAAAAAAAGCACCCTTACGGGTGCAAAGAGACAGACTTTAATACATTAAACTGCGTGTTGAATGCCTTGTAATTTTGCAATTTCTTGTTGTTTTAGTAAATTACGTTGAATTTTACCACTCGATGTTTTCGGTAAACTCTCTACAAATTCAATCTCACGTGGATAAGAATGCTTAGACAAACGAGAACGTACATATTCTTGTAACTGATTTGCCAAGGTCTCTGAAGCCAAAGTTTGTGTTTTCAAAACGACAAAGGCTTTTACGATCTCAGTTCGTTCTGGATCAGGTTTGCCGATCACTGCTGATTCCAAAACTTCAGTACATTCCAAAAGTGTGCTTTCTACATCAAAAGGACCGACTCGATAGCCTGATGTTGTAATGACATCATCAGCACGTCCAACAAAATCTACACCACCCAACTCATTGAATTTTACGGTATCACCAGTTAAATAATAATTTCCCA # Questionable array : NO Score: 6.02 # Score Detail : 1:0, 2:3, 3:0, 4:0.96, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCATATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:58.62%AT] # Reference repeat match prediction: F [matched GTTCACTGCCATATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.20,-8.40] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-3] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [48.3-68.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.91,0.64 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 438-50 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000054.1 Acinetobacter sp. CFCC 10889 contig00055, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 437 28 100.0 32 ............................ AAAAATCTCTTAAATTCGGATTAAGACTCGGC 377 28 100.0 32 ............................ GTATATTGCTATTGGCTTAACTGGCTATAAAG 317 28 100.0 32 ............................ ATCACAGATTCCTATTCTCAAGATTCTAGGCA 257 28 100.0 32 ............................ TGTTAAACTAAACATCTTGATAACTTCCGCTA 197 28 100.0 32 ............................ TGGCGAAACATGGTTTACAAAAAAAGAAATGG 137 28 100.0 32 ............................ ATAACCTAGATTAAGTGACTCGAAATAAGCCT 77 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 7 28 100.0 32 GTTCACTGCCATATAGGCAGCTTAGAAA # Left flank : TATAAAAACCAATATCTTGTTCTGTATAGGCAATTTGTCGTTGTAAATTGCTGATCTCGATAGTATCCGCATCAATCAGCGTGATTTTTCCTACACCTGCCCGTGCAAGTAATTCTGCTGTGGTACAACCGATTCCACCACAGCCTACAATCAAAACATTTGCCAGTTTTAGTTTTTCTTGGGCTTCTAAGTCCCAACCATCAAGTAAAATCTGACGTGAATAGAGCTGCATTTCGGACTCATTTAGCTCTAAATCTGTTGTTAAGTCGTCATTTTGCATCATGAATCTATCCGAAATTGCGCGATCTTTGATTATAGGTAAATTTTTTAAAATATGTGCAGAAGTGTTTTGACAATTGTTGTTTTTTACCCCAAAATTTTCACACTCTTTAACAGCCTAATAAAATCAATAAGTTATAAAACAGTAAAAAACTTTGGGTATTTTATGGTTTTTCAGCCTATCCCTCTGTTATTTTGAAGTTTTATTGCTTAAAATTACT # Right flank : AACCTTAACTGCTGCCTTAACACGATTAAACGCGTTCACTGCCATATAGG # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCATATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:57.14%AT] # Reference repeat match prediction: R [matched GTTCACTGCCATATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.40,-7.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [45.0-73.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.37,4.77 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 106643-105771 **** Predicted by CRISPRDetect 2.4 *** >NZ_LQXQ01000007.1 Acinetobacter sp. CFCC 10889 contig00007, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================= ================== 106642 28 100.0 32 ............................ ATCAAGCCTGTGTCTTGGAAAAAGCACGATTT 106582 28 100.0 33 ............................ CATATTTGCTGCGCTTTTATTGCTTGCGACTGT 106521 28 100.0 32 ............................ AACTGGGCGCGCTATTTGCGATGTCATGCACA 106461 28 100.0 32 ............................ TGTTGTTTGCAATTCAAAAGCATAAGTACGTT 106401 28 100.0 33 ............................ GCTTAACTTCTCGTTTGCTTGTTTAGCGCCATC 106340 28 100.0 32 ............................ TGAATCAATCGGAATCATGGTGATATTTGGGA 106280 28 100.0 32 ............................ TATAGCGAACCACGAGAAGCCCCGCAACCCCT 106220 28 100.0 32 ............................ AAAAGGTAAAAATGGAAATTCTAATACTGCTA 106160 28 100.0 32 ............................ TAAAACATCAGCGGGCAAACTATAAAATAATC 106100 28 100.0 32 ............................ TATAGCGAACCACGAGAAGCCCCGCAACCCCT 106040 28 100.0 32 ............................ TGCAACAAGAGTCGGTGACGATGCTAAAACAA 105980 28 100.0 33 ............................ GCCCCACGTTATCGGTGCTGCTGTTGTGTTTGT 105919 28 100.0 32 ............................ ATGTTCGAAATAAAACAGGTGGAACTCAGGCG 105859 28 100.0 32 ............................ TGAAGAAAGTACTAACAAAACAACAGTCATCT 105799 28 96.4 0 ........................A... | T [105773] ========== ====== ====== ====== ============================ ================================= ================== 15 28 99.8 32 GTTCACTGCCGTATAGGCAGCTTAGAAA # Left flank : CAGCTTAGAAAATACCCTGTATTTTCAATAGTTAAATGCGTG # Right flank : GTGAATATAAGATTATTCACTTATTACCAAGGGACTACTAATCAGTAAAATTTATAAAAATATAGATTACTTATGTTTAGTGTAAATAATATCTGATAAATCAAAACCCAGTGTTTTAGCATAATCTAGATATTCATTTAATATTTGTTGATCAATGTTTGGATCACGACTTAAAACCCATAAATATTTTTTATTAGGACTTCCCACTAAAGCAGTTTGATAATTTTCATCCAGTTTCAAAATCCAATAATCGCCACGACCGACAGGAAGCCAACGAACTAGTTTAGGTAAAAATGTTACTTTAAGCTTACTATTTTGAGGTGGATTTTTAACAAAAGCTTCGCCAATTGATTGATTTAATTTACCATCTTTACTGAAACATTTATTATCAACTACCACATTTCCTTTATCATTTAATGAATAATTTGCTGTGACATTGTAGTCACATACTTTTTGAAAATATAAAGGTTTTCTTGCAATTTCATGCCACTGACCTGCAT # Questionable array : NO Score: 6.25 # Score Detail : 1:0, 2:3, 3:0, 4:0.99, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCGTATAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:53.57%AT] # Reference repeat match prediction: R [matched GTTCACTGCCGTATAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.70,-8.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: R [2-0] Score: 0.41/0.41 # AT richness analysis in flanks prediction: F [76.7-48.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.27,5.28 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], //