Array 1 360-32 **** Predicted by CRISPRDetect 2.4 *** >NZ_AKZL01000109.1 Shewanella sp. POL2 contig00109, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 359 28 100.0 32 ............................ AATACGCTGGTGGACGCCCTGTGCCGCACGAA 299 28 100.0 32 ............................ ACTTGGCGACTTGATAGCCGTTATTGCCGAGA 239 28 100.0 32 ............................ TAACTGCCACTGACGGCCATTGCCTCGTCACT 179 28 100.0 32 ............................ GCACTTGGCTACTCACTACCGCTTTAAGCGAA 119 28 100.0 32 ............................ ATTATGCTCACATCAACCTGCTTACCCGTAGC 59 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 6 28 100.0 32 GTTTACTGCCTTACAGGCAGCTTAGAAA # Left flank : GATGTAACTTACGTAAGCTTTGTACGCAAGCAGGTGAAATCGCCCGAACGAATAGAGCGGGATATGCAGCAAAAAGCCGCACTATGGGCAGCAAAATCCGGTAAACCGCTGGTGGAATGTTTAGCGGATTTGCAACAAAGCAAGCCGACAACATTGTGCTCTTTGCCGTTTATTTACTTGCATAGCCAGCAAACCAAGCAACGCTCACCAGAAAAAAACAGCAAGTTTCCGCTGTTTATTCAGATGCAGCAGCAAAGCACATCACAAGATGGGAGCTTCGATTGCTATGGCTTGAGTAGCAAAGCGAATGGACAGTCAATGTTGGCTACCGTACCGCACTTTTAAATTGAACGAAAAGGTAAGTTTTAACCCTTTATTTTTTGCTCTTTAAAAATATAATTTAAATACAATAAGTTACAATGGGTGGTTTTTAATAAGGTAAAAAAGTAATTTTTATCCTAACTGCCTGTTGTAACTTATTTTTATTGATTTAGTCTATT # Right flank : AACCATGCAAATGGCATGGTCATTGTGGTTAA # Questionable array : NO Score: 6.26 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTACTGCCTTACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:57.14%AT] # Reference repeat match prediction: R [matched GTTCACTGCCTTACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.20,-7.60] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [30.0-78.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.37,4.77 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 353-32 **** Predicted by CRISPRDetect 2.4 *** >NZ_AKZL01000224.1 Shewanella sp. POL2 contig00224, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ =============================== ================== 352 28 100.0 31 ............................ AGATGGCAAGAAAGTGATTGCTAGGCACTAC 293 28 100.0 31 ............................ GCCTAAAACGACACCACAAATAGGCCCACGC 234 28 100.0 30 ............................ ATTAAACGAAACTGATGTTCCAGAAGATCA 176 28 92.9 31 TG.......................... GTCGATTTCTTTGATGGCTTCTACCACGCTA 117 28 100.0 30 ............................ GCACATCAAAAAATCCAATGTGAAGTTACG 59 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ =============================== ================== 6 28 98.8 31 GTTTACTGCCTTACAGGCAGCTTAGAAA # Left flank : GCTA # Right flank : AATAAACGCGACGTACTTCTGCCGAAATGGCT # Questionable array : NO Score: 6.20 # Score Detail : 1:0, 2:3, 3:0, 4:0.94, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTACTGCCTTACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:57.14%AT] # Reference repeat match prediction: R [matched GTTCACTGCCTTACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.20,-7.60] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [26.7-5.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.64,4.5 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 57-321 **** Predicted by CRISPRDetect 2.4 *** >NZ_AKZL01000229.1 Shewanella sp. POL2 contig00229, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 57 28 100.0 31 ............................ TGCACAAGGGTATTAATGTTCCAAAGCTTGC 116 28 100.0 32 ............................ GCGCAGGATGTGATTTTCGAAATCGAGAATAC 176 28 100.0 32 ............................ GACTCCTGCGAGCACGAGCTCGTGCCAGAATT 236 28 96.4 30 ...C........................ TTGCGTACGCCAATCTCGCTGCAGTTGCCC 294 28 96.4 0 ...C........................ | ========== ====== ====== ====== ============================ ================================ ================== 5 28 98.6 32 GTTTACTGCCTTACAGGCAGCTTAGAAA # Left flank : CTGCCTTACAGGCAGCTTTAGAAAACGCTGTTTAGCTAAACGGGCAAGCAGCTCGTG # Right flank : A # Questionable array : NO Score: 5.99 # Score Detail : 1:0, 2:3, 3:0, 4:0.93, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTACTGCCTTACAGGCAGCTTAGAAA # Alternate repeat : GTTCACTGCCTTACAGGCAGCTTAGAAA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:57.14%AT] # Reference repeat match prediction: F [matched GTTCACTGCCTTACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.60,-8.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [46.7-1.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.77,0.37 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 300-33 **** Predicted by CRISPRDetect 2.4 *** >NZ_AKZL01000230.1 Shewanella sp. POL2 contig00230, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 299 28 100.0 32 ............................ ATTTTGTCCAATATCTATAGTTGCTGGAAAGC 239 28 100.0 32 ............................ TCCAGAGGAAAAGCATCATCCTTTTTACAAGG 179 28 100.0 31 ............................ AATGGTAAACATGGCGCAAAAGCCTCAGATG 120 28 100.0 32 ............................ AGCAACCCAGAGAGCTGGCTCAATGCCCTGCG 60 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 5 28 100.0 32 GTTCACTGCCTTACAGGCAGCTTAGAAA # Left flank : GTAATAATGGGATATTA # Right flank : ATGCTTGAGGCATTAAATAAGCAAGGCCCAGGT # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCTTACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:53.57%AT] # Reference repeat match prediction: R [matched GTTCACTGCCTTACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.20,-7.60] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [28.3-23.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.37,4.5 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 3-268 **** Predicted by CRISPRDetect 2.4 *** >NZ_AKZL01000233.1 Shewanella sp. POL2 contig00233, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 3 28 100.0 32 ............................ GTGAAGTGGAATACAACCGTCAAAACCACATG 63 28 100.0 30 ............................ CATTGCTTGTTTACTTGAGGGTACTGTGGT 121 28 100.0 32 ............................ GTTTCAGCGAGCATTGATAAAAACACGGCGGC 181 28 100.0 32 ............................ GCAATACCGCGAATTAACGGATGAATTCCTCT 241 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 5 28 100.0 32 GTTCACTGCCTTACAGGCAGCTTAGAAA # Left flank : TCG # Right flank : CAACGCCTTTGCAAGTTGAGCTAGGACGA # Questionable array : NO Score: 6.06 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.8, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCTTACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:53.57%AT] # Reference repeat match prediction: F [matched GTTCACTGCCTTACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.60,-8.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [1.7-23.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.5,0.64 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 25-229 **** Predicted by CRISPRDetect 2.4 *** >NZ_AKZL01000238.1 Shewanella sp. POL2 contig00238, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 25 28 100.0 29 ............................ ACATCGGCAGGGCGAAAGTAAAGGATAAA 82 28 100.0 32 ............................ TATATCTCACCGTCAACAATAAAATATTAAAA 142 28 100.0 32 ............................ CATTAACTAAGAGGCCCGCCACATCGGCAGGG 202 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 4 28 100.0 31 GTTCACTGCCTTACAGGCAGCTTAGAAA # Left flank : GGTGTGGCATCGGCATCGGTAGAGG # Right flank : ACGCT # Questionable array : NO Score: 5.86 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCTTACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:53.57%AT] # Reference repeat match prediction: F [matched GTTCACTGCCTTACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.60,-8.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [15.0-3.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.77,0.37 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 197-49 **** Predicted by CRISPRDetect 2.4 *** >NZ_AKZL01000240.1 Shewanella sp. POL2 contig00240, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 196 28 100.0 32 ............................ TAAATGTGCTGGACAATCATTTACGTCACGGT 136 28 100.0 32 ............................ ATACTGGCACTCACTGACTCAGATCTCAAGTG 76 28 100.0 0 ............................ | ========== ====== ====== ====== ============================ ================================ ================== 3 28 100.0 32 GTTTACTGCCTTACAGGCAGCTTAGAAA # Left flank : GCCGCAGGCAGTGGTTC # Right flank : AACAAGCTGGTACTGCTGCCACTGTTCAATTCAGTTTACTGCCTTACAG # Questionable array : NO Score: 5.67 # Score Detail : 1:0, 2:3, 3:0, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTACTGCCTTACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:57.14%AT] # Reference repeat match prediction: R [matched GTTCACTGCCTTACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-8.20,-7.60] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [43.3-10.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.64,4.5 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], // Array 1 8-334 **** Predicted by CRISPRDetect 2.4 *** >NZ_AKZL01000096.1 Shewanella sp. POL2 contig00096, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================ ================== 8 28 100.0 32 ............................ GTGAAAACCACATGGTGACCGCCAACGACCCC 68 28 100.0 32 ............................ TGATGGGTACATTTCGCGGCGGCGTTTTAAAT 128 28 100.0 32 ............................ TATATTCGATGGTGAACTAAAATGCCTACATA 188 28 96.4 32 .....T...................... AAATGAAAGGTTTTCTGTGGCCTTTTGCACCT 248 28 100.0 31 ............................ CGCGAGGACTAGGGCGCAGCCGACGGCTTTT 307 28 78.6 0 A.....CA.T.C......G......... | ========== ====== ====== ====== ============================ ================================ ================== 6 28 95.8 32 GTTCACTGCCTTACAGGCAGCTTAGAAA # Left flank : CGACCCCG # Right flank : AGCTAGCCAAGTTTTACTGTAGCTAAAGCACAAGTTTGATTTGTTGTTCGTTGAAGCGACCTAATAGCGTTAAGCCTCTTTAGTGAGGCTTTTTTATTCGTTTTTTTCTAGATACTGCTCACTAAAACCTTTCAAAAATGCATGCGCTGATGTGCCACAGGCAAGGCAAACCTGCTCAAGTTCTAAGATTTTGAGTTGACGCTCCCCGCTCTCGTACTTGGATACGAAACTTTGGGGCTTTTCTAATTTAAGAGCGAGCTCACTTTGACTGAGGCCTGCATTTTTACGCATAGCTTTCAATTCATTACGTAAGGCTTCTTCTCTATCCGACCATAGCTTTTGTTTCATGGGCCGATAGTAGACGAAGTTGTAAAATATCCCATTTTGGGATATTTTGGTTATGTATTAGGGTTTCTAATATGAGTTTGGAGGTTGGTTATTGCATCAAATCTGACTGAACCAGTTGATGGGGTAAATCTAATATATTTTCTCTATCCGCT # Questionable array : NO Score: 6.05 # Score Detail : 1:0, 2:3, 3:0, 4:0.79, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTCACTGCCTTACAGGCAGCTTAGAAA # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: NA [Repeat is AT rich:53.57%AT] # Reference repeat match prediction: F [matched GTTCACTGCCTTACAGGCAGCTTAGAAA with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-7.60,-8.20] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-7] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [1.7-58.3]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.91,0.64 Confidence: HIGH] # Array family : I-F [Matched known repeat from this family], //