Array 1 263-39 **** Predicted by CRISPRDetect 2.4 *** >NZ_AEEA01000091.1 Treponema primitia ZAS-1 TPRIMZ1_00092, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== =============================== =================================== ================== 262 31 100.0 35 ............................... TCATTTCTGTAGAGTGAAACCTTTTCACCATTAAG 196 31 100.0 33 ............................... CCCAGGGGAATAGTTTTATCAGGGAAAACGGAA 132 31 100.0 32 ............................... ATTGATGATGGCGCTAACTGCTCCCGGTACAT 69 31 100.0 0 ............................... | ========== ====== ====== ====== =============================== =================================== ================== 4 31 100.0 34 GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Left flank : GACCATAGGCGTATTTGCGGCATGGCTCCATC # Right flank : CCCGGTGACGTTACGCCAGTATATTACGCAAAGCACAAA # Questionable array : NO Score: 8.86 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: R Score: 4.5/4.5 # A,T distribution in repeat prediction: F [7,5] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTCGCACCCTCACGGGTGCGTGGATTGAAAC with 94% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-3.50,-6.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [33.3-25.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.37,9.37 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 224-62 **** Predicted by CRISPRDetect 2.4 *** >NZ_AEEA01000087.1 Treponema primitia ZAS-1 TPRIMZ1_00088, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== =============================== =================================== ================== 223 31 100.0 35 ............................... ACTATAGCAACTGTATGTATGGACAGTATAGCCTA 157 31 100.0 34 ............................... ATTTAATAATGAATGTGATTACTGCGTTGACAAT 92 31 100.0 0 ............................... | ========== ====== ====== ====== =============================== =================================== ================== 3 31 100.0 35 GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Left flank : TTT # Right flank : CGATTATGTCGATTGCGTAGGGGTACGATTCCAGGGGTCGCACCTTCGCGGGTGCGTGGATT # Questionable array : NO Score: 8.67 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: R Score: 4.5/4.5 # A,T distribution in repeat prediction: F [7,5] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTCGCACCCTCACGGGTGCGTGGATTGAAAC with 94% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-3.50,-6.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [41.7-6.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.64,9.37 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 243-11 **** Predicted by CRISPRDetect 2.4 *** >NZ_AEEA01000073.1 Treponema primitia ZAS-1 TPRIMZ1_00073, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== =============================== ===================================== ================== 242 31 100.0 37 ............................... GTTGTAGTGGATATACCCTCGGTCTACTCCCTCGTAA 174 31 100.0 36 ............................... GATATGCAGGAAAAACATGCGGATAATAACCAACGG 107 31 100.0 35 ............................... TTTATATCAGCAATGGCAGAGACGATAACGGTCTT 41 31 100.0 0 ............................... | ========== ====== ====== ====== =============================== ===================================== ================== 4 31 100.0 36 GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Left flank : ACCCACCCCAGCAGCTTGGCCGCCTCAAACCTCCG # Right flank : CAAAAGCTTAA # Questionable array : NO Score: 8.86 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: R Score: 4.5/4.5 # A,T distribution in repeat prediction: F [7,5] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTCGCACCCTCACGGGTGCGTGGATTGAAAC with 94% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-3.50,-6.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [13.3-18.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.37,9.37 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 276-45 **** Predicted by CRISPRDetect 2.4 *** >NZ_AEEA01000074.1 Treponema primitia ZAS-1 TPRIMZ1_00074, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== =============================== ===================================== ================== 275 31 100.0 34 ............................... AGCACTACCATGAAAGAGGTCCAGGTAACTTTGA 210 31 100.0 36 ............................... TACAGATGCAAGAGCAACATTGATAAGGCATTCCCC 143 31 100.0 37 ............................... AAACAGTAGTAAAACTGTTTAATCAGCAGAGGGATAT 75 31 100.0 0 ............................... | ========== ====== ====== ====== =============================== ===================================== ================== 4 31 100.0 36 GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Left flank : GCTGTACCTGGGACTATTCCAAGTCTCTAAA # Right flank : CTTCAAGGTCCACAATGGCAAGGATTGACGCTTGTGGTCGCACCT # Questionable array : NO Score: 8.86 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: R Score: 4.5/4.5 # A,T distribution in repeat prediction: F [7,5] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTCGCACCCTCACGGGTGCGTGGATTGAAAC with 94% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-3.50,-6.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [35.0-30.0]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.37,9.37 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 508-10 **** Predicted by CRISPRDetect 2.4 *** >NZ_AEEA01000068.1 Treponema primitia ZAS-1 TPRIMZ1_00068, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== =============================== ===================================== ================== 507 31 100.0 36 ............................... TAGTTCATCCGGCATACTCTTTAGGTGTACATCAAG 440 31 100.0 36 ............................... GTCCATGATTCGGTTGATATACGTCCCGATATTCTC 373 31 100.0 36 ............................... AAAAATGAACGCTACGAAACAGTATTTTTCAAGGTC 306 31 100.0 37 ............................... AATTATTACCAGCATTGAGGAACGAACCCCTGACCCG 238 31 100.0 33 ............................... GTTAAATCGCTCTCCTGGACTAGATACCACTGC 174 31 100.0 36 ............................... TCATGCCGAAAGCAATCGGCGATTACCGGGCAAAAA 107 31 100.0 36 ............................... AAGAACCTTAAAACCATGCCGGTCCGGCAGTTTGCA 40 31 100.0 0 ............................... | ========== ====== ====== ====== =============================== ===================================== ================== 8 31 100.0 36 GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Left flank : CCTGATCTAATAGAGTATCCCCATCATAAAGTCGGAA # Right flank : CCGTNGCGTT # Questionable array : NO Score: 9.26 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: R Score: 4.5/4.5 # A,T distribution in repeat prediction: F [7,5] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTCGCACCCTCACGGGTGCGTGGATTGAAAC with 94% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-3.50,-6.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [5.0-36.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.37,9.64 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 187-22 **** Predicted by CRISPRDetect 2.4 *** >NZ_AEEA01000067.1 Treponema primitia ZAS-1 TPRIMZ1_00067, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== =============================== ===================================== ================== 186 31 100.0 37 ............................... AGGGTAAACTCCATGAACCCGCTTTGGATAGATTCCC 118 31 100.0 35 ............................... TAAAGTATACTGTGGCCCAGCAGTGGCGGGTGGAC 52 31 100.0 0 ............................... | ========== ====== ====== ====== =============================== ===================================== ================== 3 31 100.0 36 GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Left flank : GGGCGGGAGGTGTTACACCAACAGGACAGGG # Right flank : CAGCATCGCGCCCTGTGATTCC # Questionable array : NO Score: 8.67 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: R Score: 4.5/4.5 # A,T distribution in repeat prediction: F [7,5] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTCGCACCCTCACGGGTGCGTGGATTGAAAC with 94% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-4.30,-6.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [13.3-18.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.78,9.37 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 266-34 **** Predicted by CRISPRDetect 2.4 *** >NZ_AEEA01000066.1 Treponema primitia ZAS-1 TPRIMZ1_00066, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== =============================== ===================================== ================== 265 31 100.0 36 ............................... TTAAGGATATCCTTGCCATAGTCCTGCTCTACACGC 198 31 100.0 37 ............................... GCTCCGGGCGGTATCCAGAGCGTAGATACACCCCAAA 130 31 100.0 35 ............................... GAAAAATAGCGGAGCTTGCGGATATAGCTTCGGCT 64 31 100.0 0 ............................... | ========== ====== ====== ====== =============================== ===================================== ================== 4 31 100.0 36 GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Left flank : ACTGGTAAGTTATGATGTGATGGTAACCAGCCCGGGCGGCCCTGGTCGTTTGCGAAAAGTGGCGAAAGCCTGTACAAACTTCGGGCAGCGGGTTCAATATTCGGTCTTTGAATGTGTGGTTGATCCGGCCCAATGGGTCAATCTAAAGAACACTTTGGAGAAAATAATAGATGACAAGATAGACAGTCTGCGGTATTATTATCTTGGCGCCAATTACAAACGGCGGATAGAACATGTGGGCGCAAAACCTTCCTACGACGTAGACGGTCCTTTAGTCGTTTAAAATCCCTTTTTAGCAGTTTCTTACAGATCAGCCTTTTGTTTTGCGAACCCCCATGACACAGAATAGTCTGGCAGGTTCGCAGTGACTATAATTCCTTACAGGATAGATATTTGACAAAATAGGGAAGGGAAAACCAACTATTAATGCACCTTTTATATGATGTTTCGCGAATAAGGGGCTGTAACTTGTTGTAATATATGAATATAATAGAGTGTGA # Right flank : CCGTTACACAATCAATATCACTGGTAAGTTTTGG # Questionable array : NO Score: 8.86 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: R Score: 4.5/4.5 # A,T distribution in repeat prediction: F [7,5] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTCGCACCCTCACGGGTGCGTGGATTGAAAC with 94% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-3.50,-6.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: R [35.0-66.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.37,9.64 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 30-179 **** Predicted by CRISPRDetect 2.4 *** >NZ_AEEA01000033.1 Treponema primitia ZAS-1 TPRIMZ1_00033, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================ ================================= ================== 30 28 100.0 33 ............................ TACCCAGGATACTAACCCACCAGTTTTCACTTG 91 28 100.0 33 ............................ CGTCCCGTACACCTGGCTTATGGCACAGTTAGA 152 28 78.6 0 ...............A..T..A.A.G.T | ========== ====== ====== ====== ============================ ================================= ================== 3 28 92.9 34 GTTTTCCCCACACACGTGGGGGTGTTTC # Left flank : CCTACTCCCGCGACAACACCGCGTGGATCG # Right flank : TAAGGCGTAAAAAAATGCGGCCCCTCCCCTTTCAGGCAAGGACCGCATCCTGTAACGAAACTTTCTATTCCCTACGCCTTGGCGACAACCTCGGCGCCGGCGTTAACCGCATCGGTTGAAATATCATCGACCGCAATAACTGTACCGGGATCATCGGAGATTTTAACGGTAAGCAGGCCAAAGGCGGTCATGATCAGTACTGCTATGGGCATCAGGTAGTTAAAGAAAGCCCAGGGCGCGTATTGGAGGGTGGAAACCCCCAGGACGCCGGTGAGGAACACACCGCAGGTGTTCCAGGGTATCAAGGCGCTGGTCACCGTGCCCGAGGCTTCCAGGGCGTTACTCAGCATCTTGGGGTGAAGACCCCGTTTGCGGTACGTGGCGTTGTACATACGGCCGGGTACCACAAGCGAGATATACTGCTCAGGCATGGTAGCGTTACTGCCAAAACAGGTAAGCAGGGTAAGCCCCACCAGGGAAGTAGTACCCCGGGCGAATTT # Questionable array : NO Score: 5.01 # Score Detail : 1:0, 2:3, 3:0, 4:0.65, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:0.69, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTCCCCACACACGTGGGGGTGTTTC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [3,9] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTCTTCCCCACGCACGTGGGGGTGTTTC with 96% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-11.50,-10.80] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-6] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [16.7-46.7]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [5.28,0.64 Confidence: HIGH] # Array family : I-E [Matched known repeat from this family], // Array 1 1-145 **** Predicted by CRISPRDetect 2.4 *** >NZ_AEEA01000032.1 Treponema primitia ZAS-1 TPRIMZ1_00032, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== =============================== ==================================== ================== 1 14 45.2 33 -----------------.............. CCGNCACAGACGGACCAAGCAAACTGCCCTACC 48 31 100.0 36 ............................... CTTTATGGTCCGCTCAATAGTCGGCCCTACCCTTCT 115 31 100.0 0 ............................... | ========== ====== ====== ====== =============================== ==================================== ================== 3 31 81.7 35 GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Left flank : | # Right flank : TCTGCCAGGGTGTTTATAAATTGTACGGCTGGT # Questionable array : NO Score: 7.45 # Score Detail : 1:0, 2:3, 3:3, 4:0.09, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:0.69, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: F Score: 4.5/4.5 # A,T distribution in repeat prediction: NA [4,4] Score: 0.37/0.37 # Reference repeat match prediction: F [matched TCGCACCCCATGCGGGTGCGTGGATTGAAAT with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [0.00,0.00] Score: 0/0.37 # Array degeneracy analysis prediction: R [1-0] Score: 0.41/0.41 # AT richness analysis in flanks prediction: R [0.0-30.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [9,0.68 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 395-164 **** Predicted by CRISPRDetect 2.4 *** >NZ_AEEA01000031.1 Treponema primitia ZAS-1 TPRIMZ1_00031, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== =============================== ===================================== ================== 394 31 100.0 37 ............................... CTAATCCTGGACACTTGTCCAGGGCTGTAAATACCAC 326 31 93.5 34 ....A.............T............ GTAATATAATAGATAGAGAAATGATTATTATAAA 261 31 100.0 36 ............................... TATCAACATCTTCATGGGCCAACCCTACAAAGACCA 194 31 100.0 0 ............................... | ========== ====== ====== ====== =============================== ===================================== ================== 4 31 98.4 36 GTCGCACCTTCACGGGTGCGTGGATTGAAAC # Left flank : AGGGAGGATGCCGGATAAACCGCTTTTGTGG # Right flank : CCCGTCCTCCGAAAAGGAGTAAATTAGTGCATACATGCAAAGCTATAAACGAAAACTGGGGACGACTTCCGGGGAGGTAGAACTGAAGGTGTCCAAATTAAAAACGGTATCCTTTGAGACCGCTATTATAGAACGGTACCGAAGGAGGGAAAGCAGCGTGGAGT # Questionable array : NO Score: 8.78 # Score Detail : 1:0, 2:3, 3:3, 4:0.92, 5:0, 6:0.25, 7:0.01, 8:0.6, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCTTCACGGGTGCGTGGATTGAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: R Score: 4.5/4.5 # A,T distribution in repeat prediction: F [7,6] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTCGCACCCTCACGGGTGCGTGGATTGAAAC with 97% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-3.30,-6.40] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-2] Score: 0.41/0.41 # AT richness analysis in flanks prediction: F [56.7-25.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [1.05,9.37 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 4-144 **** Predicted by CRISPRDetect 2.4 *** >NZ_AEEA01000168.1 Treponema primitia ZAS-1 TPRIMZ1_00169, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== ============================= ================================ ================== 4 29 96.6 32 ....................G........ CGAAGATCTGGATTTCCGGCGGATATTCGGTG 65 29 100.0 31 ............................. TACGGACGATCAGAGCGATATGCTCCGCAAT 125 20 69.0 0 ....................--------- | ========== ====== ====== ====== ============================= ================================ ================== 3 29 88.5 32 GTTTTCCCCACACACGTGGGAGTGTTTCT # Left flank : GGCG # Right flank : GGTGTTTC # Questionable array : NO Score: 5.09 # Score Detail : 1:0, 2:3, 3:0, 4:0.42, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTTTTCCCCACACACGTGGGAGTGTTTCT # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: NA Score: 0/4.5 # A,T distribution in repeat prediction: R [3,5] Score: 0.37/0.37 # Reference repeat match prediction: F [matched CTTTTCCCCACACACGTGGGGTTGAACCG with 100% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: NA [0.00,0.00] Score: 0/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [0.0-6.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [4.5,0.37 Confidence: HIGH] # Array family : I-E [Matched known repeat from this family], // Array 1 459-35 **** Predicted by CRISPRDetect 2.4 *** >NZ_AEEA01000162.1 Treponema primitia ZAS-1 TPRIMZ1_00163, whole genome shotgun sequence Array_Orientation: Reverse Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== =============================== ==================================== ================== 458 31 100.0 35 ............................... TGGGAAAAGCGGATAGCTGCCATAAACCGTGGCGA 392 31 100.0 36 ............................... ATTTACAGTTGGCATGAGTGCGTATTGTGGGCGTAG 325 31 100.0 35 ............................... AGGATTCCGCCGCTGCCCGTCAGCGGATGGTTAAG 259 31 100.0 32 ............................... GAGTCCTGCGGTCCCAAAAGGTCTTTTTCCTG 196 31 100.0 35 ............................... AAATTACCGATTCGATGGACGATCTTAAAAATGAG 130 31 100.0 34 ............................... TCAAAGAAACGGAAAAGCTGAAATCCATGTGTGT 65 31 100.0 0 ............................... | ========== ====== ====== ====== =============================== ==================================== ================== 7 31 100.0 35 GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Left flank : CATGATGAGCAGAAGTCTGACGCCTGAACAGCG # Right flank : CCGGTGTAATACCGCATAGTAAACGCCAGCTCACC # Questionable array : NO Score: 9.26 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.01, 8:1, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: R Score: 4.5/4.5 # A,T distribution in repeat prediction: F [7,5] Score: 0.37/0.37 # Reference repeat match prediction: R [matched GTCGCACCCTCACGGGTGCGTGGATTGAAAC with 94% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: R [-3.50,-6.00] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: NA [26.7-26.7]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: R [0.37,9.37 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 36-199 **** Predicted by CRISPRDetect 2.4 *** >NZ_AEEA01000146.1 Treponema primitia ZAS-1 TPRIMZ1_00147, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== =============================== ==================================== ================== 36 31 100.0 36 ............................... AACGGACCCTGGGATTTGTTAGATGATTATATCGGG 103 31 100.0 35 ............................... CGATCCCACCCATCCATATTATTAGTAGAGGTGCT 169 31 96.8 0 ...........A................... | ========== ====== ====== ====== =============================== ==================================== ================== 3 31 98.9 36 GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Left flank : TGTACGTCCGCCATATCCAACACAATCCGTTTATCG # Right flank : CAAAGCTGTCATAAGGTCCTTATACTTAGGCAGTC # Questionable array : NO Score: 8.31 # Score Detail : 1:0, 2:3, 3:3, 4:0.95, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:0.69, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: F Score: 4.5/4.5 # A,T distribution in repeat prediction: R [5,7] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTCGCACCCTCACGGGTGCGTGGATTGAAAC with 94% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-6.00,-3.50] Score: 0.37/0.37 # Array degeneracy analysis prediction: F [0-1] Score: 0.41/0.41 # AT richness analysis in flanks prediction: NA [31.7-33.3]%AT Score: 0/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [9.78,0.37 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], // Array 1 45-206 **** Predicted by CRISPRDetect 2.4 *** >NZ_AEEA01000145.1 Treponema primitia ZAS-1 TPRIMZ1_00146, whole genome shotgun sequence Array_Orientation: Forward Position Repeat %id Spacer Repeat_Sequence Spacer_Sequence Insertion/Deletion ========== ====== ====== ====== =============================== ==================================== ================== 45 31 100.0 36 ............................... AACTAATGGTGGGAACCATGACCAGGGTATTGTTTG 112 31 100.0 33 ............................... TCGAAAAACACCATTGAGAGTTATGAATCTTAT 176 31 100.0 0 ............................... | ========== ====== ====== ====== =============================== ==================================== ================== 3 31 100.0 40 GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Left flank : GGATTGAAACGCCGCCAAATGCTCCTATCGTCAATCCATCATAAG # Right flank : | # Questionable array : NO Score: 8.67 # Score Detail : 1:0, 2:3, 3:3, 4:1.00, 5:0, 6:0.25, 7:0.02, 8:0.4, 9:1, # Score Legend : 1: cas, 2: likely_repeat, 3: motif_match, 4: overall_repeat_identity, 5: one_repeat_cluster, 6: exp_repeat_length, 7: exp_spacer_length, 8: spacer_identity, 9: log(total repeats) - log(total mutated repeats), # Primary repeat : GTCGCACCTTCGCGGGTGCGTGGATTGAAAC # Alternate repeat : NA # Directional analysis summary from each method: # Motif ATTGAAA(N) match prediction: F Score: 4.5/4.5 # A,T distribution in repeat prediction: R [5,7] Score: 0.37/0.37 # Reference repeat match prediction: F [matched GTCGCACCCTCACGGGTGCGTGGATTGAAAC with 94% identity] Score: 4.5/4.5 # Secondary Structural analysis prediction: F [-6.00,-3.50] Score: 0.37/0.37 # Array degeneracy analysis prediction: NA [0-0] Score: 0/0.41 # AT richness analysis in flanks prediction: F [40.0-0.0]%AT Score: 0.27/0.27 # Longer leader analysis prediction: NA # ---------------------------------------------------------------------------- # Final direction: F [9.64,0.37 Confidence: HIGH] # Array family : I-C [Matched known repeat from this family], //